Mus_musculus Locus Mono:232:SNORA24
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:232:SNORA24
Mus_musculus
Mono:232:SNORA24
10
SNORA24
1001..1117
2117
AGTGATAGTGATTCTTTCTGCATCAAAATCTCTGAATGAGAAGAGCTATCATTCTGGAC
TCAAGCTTGGTTGAGTTCTCCCATTCACTCACTGGTCACTGCGTTAGCCATGAGCTCAGG
AAACCCTCCGTGCCTCTGGCTTCCTTCCTCTAGTTTTGGAATAAGCAGTCTCTCAGTGTT
GGAAGGGAATGTCCCAGAATGTTGGCTTCCAAGCACATAAGCTTGTCCTTTGTGGTGGTT
TAAGTGAGAATGGCTCCCATAGGCTCCAGCTGATGAAATTTTTTGTGAAGGATTAAGAGG
CACAGCCTTGTTGGGGGGGGGGGGTCACTGAGGATGGAGTCTGATGCTTCAAAAGCCCAT
GCCCCACCCCCTTCTGTCCAATGCTTGGGGATCAAATGGTGATCATGTCCATTTGAAACT
GGGAGCCCCAATAATATCCTCTTTTAAGTTGCCTTTATCACCGTGTCTCTTCACAGAGAT
ACAAATGTAACTAAGATATCCTTCAGGATTCTTCTCCTTCCCAGGTACCTTTCTGCTACT
TTGTAACACCCCAGCCATCTGATGCCTCAAAGCAAAGTCAAATTGTATTCTCTGTAACTC
AGCCATCATGTGGTTGCTGGACGCTCTCTTCCTGGTAGGCTCCATTAATCCAGATCCTCT
TTTACCTGACTGTTTTCATGATTGTATTTCCCAATCCAGGACAGTGACAAATGACACACA
GTTACTGACTGATGTTTGTTTGGATGAATTAACTCTTAAAAAAAGAACTTGTGTGAAGGG
CCAATACATCATTCTTCCTTGGGATAACTCAGTTGAAGTGCCATTAATCTCACACCACTG
ATCAGAATGAGCTTAAATTATGAATGAAAATCCAAGAGTAGGGATGGCCTTAGACACTCG
GAATGATAATGCTTTTATCTATAAGACGTTTCAAGGTCAGTTGATGGTATAGGTTATATT
GTTATATTGGTAAAAAAAAAAGCTACAATTTAAGAAAAGACTTCAGGTCTCTTTGTGACC
TGTCAACTATGACAACCCCACTTCATAGCCACAGAAGAACATGGCGAAGCTGTCACCATT
TAATTGGTGTCTGGTTCTGATTCACATAGATAACATTCTTCACTGTAAAAATTATAGGTC
ATAAAAGTACAGCCCCAGCCTCCTAACTTCCAGACTACTATTCTTTCTGCACATAGGTTA
GAATGCTCAGATACCAACCAGTCACCAGCAGAGCTTTCAACCAGATGGTGCTCTCCTACA
AAACTAAAAACTTTTGGTTGCCCACACCAGTCCTGGGTTCCAGTACTCAAACATTCTGCA
ATTAAGGTCCATTTATAAATGTATTCTGTCCTCCATACGCCTCATGTGGTAGGTTGAATA
TGCTTGGCCCAGGGAGTCGCAGGATTAGGAGATGTGGCCTTGTTGGAGTAGGTGTGGCAG
TGTTGGAGGAAGTGTGTCACTTTGGGGGAAGACAATGAAACCCTCCTCCTATCTGCCTGC
AAAGAGTCTTCTCCTGGTTCCCTTTGGAACAAGATGTAGAACTCTCAGCTCCTCTAGCTC
CATGCCTGCCTGGATGCTGCCATGCTTCCTGCCTTGATGATAATGGACTGAACCTCAGAA
CCAGTAAGCTAGCCTGAACTAAATGTTGTCCTTTATAAGAGATGTGGTGGTCGTGGTGTC
TGTTCACAGCAATGGAAACCCTAACTAAGACACTTTGGTAATATATTTACTCATTTAAAA
AGAACCTGAAACAGACTGGCCTCTACTTCACTGTGCAGCTAAGGATGACCTTGAAATTCT
GAAATTCTGAGCAGTCTACTTCCTTCATCCTGAGATCACAGATGGAATCCCACAACACCT
TGTTTTCTGTTGTGTTTGGGAAGGACTGGGTTTCCTTGTTTAAAAAAAAAGAATTCTATC
AACTGAGGTATACTATATAACTCCAGCCTTTCAGTTACTATTTTAATATCTATCTTTTTT
AATTAAGTCAATTCAATTTATGTGCATGAATGTTTGGTTTGCCCATATGTATGCATACCA
CATATGTGCCTGGTGCCCACAGAGTTCATAAGATGGTGCCAGATCCTCTGGAACTGGAGT
TACAAACAATTGTGAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved