Mus_musculus Locus Poly:10:SNORD52
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:10:SNORD52
Mus_musculus
Poly:10:SNORD52
17
SNORD52, SNORD48, SNORD52
1001..1071, 1235..1297, 2293..2358
3358
CTGTGAGTTCGAGGCCAGCCTAGTCTACAGAGCAAGTTCCAGGACAGTCAGGGTTACAC
AGAGAAACCCGGTCTTGAAACCGACCCCCCCCCCCTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTCAACATAGTAGTGTGTCACGCCTGTAATTGTAGGCATGGTTGGAACCCATCTTAGA
CTATGAGCCAGATGTGTGTTTGTGTGTGTGTGGCTTTTATCCCCCTTTAAATAAAAATGT
TGGGGCTGGTGAGATGGCTCACCAGTTAAGAGCACTGGTTGCTTTTCCTGAAGTCCTGAG
TTCAATTCCCAGCAACCAAATGCTCGTGACCATGTATAAGGGAATCTGATGCCCTCTTCT
GGCACGCACGTGTACATGCAGCAGAGCACTCAGTAATCTTTTTTTTTTCTTTTTTTTTTC
TTTTTAACGGAGAGCAGAAGCTGAGGTGCAAATTCAGATTTTTCTGCTAGGTGTAGGCAA
TATGAGTCCTCCTGGGTAGACTGGATCCAAACATGAGTACAGAATCCGCAAAGCCATAAG
CCTAAAGGAGACCAAAGAGCTGACCTATCCTGTAGGAGCTCCAGGGTCTTTACCCAATCT
TGGCCGATTAGGCTGCCTGTTTCTTTCTTTCTTTTTTTTTTTTCTTTCCTTTGGATTGGT
AGTTTATCAAATTGTCGTCATATACATGATTCTCTACTTAGGACAGTAAGAAACATGATT
CCTCTTTGTTCCCTTCGCATTTGTCAGCGCGATCAAGTCAGGCATATGAGAAGACGACTA
TGTCCGTCAGGACCCCCGGGCCAGGCGTGGGTATAAATGGCCGAGGCGGGCGGCACACGG
GTCTCTTTGTGCACCCGCCCACACGGTTTGCCGTGTTTTCACCCTTCTTTGTTCTCCACC
GGTCTGGGCAGGGTCTGAGGACTCCGGAGAGCAAGGCATGGGTCCGCCTCGTGCCGCAGG
TATCCTGGGGTCCTGTGGGGAGGGCTCTGCGGTGTGGGGCCGGGTATGATGACCCACATT
TACAGACTAGAGTTTCTGATGTCCACGTGACGCCACTCCTTGTAACTGACCCAGGCCGGG
GTGGGGGCTGCAGGCCGGGGTCTCTACGACCTGTGCTCATTCAATGATCTCTTCCAGGTT
CCTGGCCCACGCCAGCCGTACCCAGTAGCACAATGGTAAGCGCATGCTGGCGAGAGGTAG
GCGGTGTGAGGAGGGGCTGGTTTCGGGGAGAGGACAGTAATGATGATTTCTGGTGATTCT
GAGTGTCTCGCTGACGCCATCACCGCAGCGCGCTGACCGTCCCCGGGTCCAAAATCGGCA
GTGGCGTGGGTTTTGAGTGGCCTAGAGTTCTGAGTAATTTACCTCTGTGTCTTGCTTTCT
GGTAGGGATTTGAGGACACACGCCAGCTGCCTACACCTGAAGAAAGGTTAGTCTTAGGTT
TCACTGGCATGCTTGTCTCTTGGCTTGACTTTTTGGAAGGGGTGGATTCGAGACAGGGTT
TCTCCATGTAGCCCTGATCTCAGATCCGCCTGCCTCTACTCTCTGGAATTAAATGCATAC
AGCACCACCGACTGGCCCTTGTTTTGTTCTTAATATCCTGCCTGCATTAGCCAGTCTCCA
AGCAAGCTACCACCCAGCCATCTTTTTGTTTTTAGATCTTAACTAATCTCCCTAACTCTA
AATCTATGGTGGATCCAGGAGCTGCCTTGATTATTTCTTGTGCCTTTAAGTTCTGTATGC
TAGTCCACGGCAGTGGGTCTCAGCCTTCCTGAGGGCCTTTAATGCAGTTCCTCGGGCTGT
GATGTTCCTAACCATCGGTTTTATTTTCCTTGTATCTTCATAACTAAAGTTTGCTATTGT
GATAACACAGGCTGTCCTGTCTGGGACCCCTATGTAAGGGTTCCTTGGTGACACAGGTTG
AGAGCCACTGTTTTAGACTATGCTTTTGGGTATTTAGACGGGCTCTCAATTCAGGATGGC
CTTAGTCCTGGCTCCAACCACCTTTTTTTTTTTTTTTTTAAGATTTAGATGTTTGTGAGT
ACACTATTGCTGTCTTCAGACACACCAGAAGAGGGCGTCAGATCCCATTACACATGGTTA
TGAGCCATCTCTCCGGCCCATGCCACCTTTTTTCGTTAAAGGTTTTAGCAGTTAAATTTC
AGTCCCCAGGAGTTTTGGCTTTATATAGCTCTGCAACAGTCCGAAGCCTAACTACACACA
CTGGCTACCGCATCCTGTGTCTATCGGATTGACATTCCCTGGGTGGTACCCTAGGTTCTG
GTCTCCCTCAATTGAGAGTGATGATTTCACAGACTAGAGTCTCTGACGCTGTCCTTGATG
TCAGCTATAAATCTGACTCATTTGGGGAACCTCTTGAGATTGAGCCCAGTGTGCCAACAC
TGGCTCTGGTGAGGAACATACCCTGCTCTCCTGTTTCTCATTGTGCCCATCTTAACTCTC
CAGGGTGAGCTCTGAGGACTTCACAGGGGCCCCATCCCCTCACCTAGATGAGGGCTAACC
TTGGAATCCAGACAAAGGTGGAAGTGACCTAGATGTGACCTGAATGAGCTAATCATCTAA
TGAGAGCCAGCCCTTTGTCCTGCCCACATGAAGGTGGGTGGTTAGCTCACTTTTCAGGGT
AATAAAGCAGTAAAGGCGGGGTGGAGGGGTTGTTGAAGGCTTTGTATGATGTCACTAGGG
CCTGTAAAGTTAGCACAATGAACCCGCTGTGCAGATTGTAAAGCTGACCTTGTTGGAATA
TCCTGGTTTTAGAAACACATAAATCAGCTTTGTGTTTGCTGTTCCCCTGCTGAAAATGTT
CTTCTGAATTTTCAGGGCTTTGCTGCTACGCACTGACAAGTTGGACGGCTTTTTATTGCT
TTGTTGCCAGTTATCTGAACATGAGAGGCTGTAAGGTGTAATCTGCGAGCCCTGCGCCCA
GACTGAACCAGGGCCTCCCTTGAACATGAGTATTAGACAAATGAAATAAGAACTTATCTT
GCCCAGACTATATAATGGCTTGGAAATGCATAGTTTCCTGAACGATCTCAATAAAATACT
TTTAAAAGTACTTAAATAGACTTTTTCTGTGTCACTTTGTGGGGAGGTGTGAGAAGATAT
ATGGGAATAAGGTTTTAACCTTACCACACAGGTGTCACCACCTGACTGCCTACATCAAAT
GCCCAGGAAGGAGCTAGTCATTTCATGTGTCTGGTTCCTGGTCCCTTAACAGCATCTGTT
CTGGAAGTACAGATGAAAATTCTATACAGACCTGTAAGGCTGACCATAGTTTTAGCAGAT
TAGCATCTGAATCGGTCAGATCTACCTGCTAGGAACAAGTCGGCCTCCCCTCCCCTAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved