Mus_musculus Locus Poly:15:SNORA16
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:15:SNORA16
Mus_musculus
Poly:15:SNORA16
4
SNORA16, SNORA44, SNORA61, SNORD99
1001..1136, 1477..1605, 1776..1905, 2227..2306
3306
CCCGGGAACTTAATCCATAGTGATGGCAGTTGGTCAGAGATTTGAGTTGAGCGCTCTGG
CCTGGGTCGAAACCACTATCAGGGCCAGACAAGGAGCAGGAACCCGGCTTTGCTAAGAAC
TACATTTCCCAGAGGCGCCGTGCGTCAGGTGGATGACGCAGACTCAGTAGAGGGCGCGAG
AGTATATAATCCTGGTGCAGGCCGTTCTCAGTCCTTTCTCGCTTCATCCGCGGTCCCTGT
CTGTTTTCGTTATGGCGCCTTGTACTTCTACCCAACGTTGCCCGCCCCCCATCTTCCCAG
CCCACCAGCTCCGTCCGCCTCTCCGGATGATTCGTGAGATACCGAGCCTGCCGGGAAGGG
ACCGGATTTTTCCGTCTGGTCCAAGGAAGCACGGGTTATGGCCACATGCGCAGTGATAAC
TCAGGGCCCCACGCCTTTTGACCCGTGAGTGTTGTAGGCTTGGGGGTGACGGGATCTGGT
AAGAGCATTTGTGCCTTTACTGGATTACGTGCTTGGGTGCAGTAACCTTATTAGGATGAC
GCCAATGGAAGGGCCTGTGACCATTACCTCCGAGCGACCTTTTTGTGATTAACCTCGCTC
CTATGTTGGGTGGAATTTGGGTCCTACCACGTGCTAGGCGATCGCTATGTCAACCATAGT
ATTAAAGCCTTAAAAAAAAAAAAGTCAGGATAATGGGCCCTACAGAGTTGGGCAAGGATT
ATACAACCTCGGCTTTCTCGCTTTCTGATTGCAAAAAGCCGCCATTTTATTCAGCTAAAC
CTGATGTCCACAGCGCGTTAAAAAGCGTTTGTAGGCGGTAGGGTCATTAATTTGAGACTG
CTTTGGGTTATAGTCAGGAACCTATCCCAATGTCTAAAGCTTCACGTATTGAACTAGGAG
CCATCGGAGCCCACAGGATTGCCTTTTCAGGCGTCTCTCTAGTAGGCAGTGGTGAGGCAT
GTGGCTTGTGGGTTTGAGGTCTAGCAATTGCTATCGCTGTCTGTGGCCCTTATCGAAGCT
GCAGCAGCTTCTACATAGCTGCTGTGGTCAAAAAGGTGGCCCAGAGAAAGAATTTTCCTT
GACGGTCGCAGTTCTGTTTCCTGTAACTGATCTGCAACATTGTGGAAAATGACAGCTTCA
CCTTACTATTTCTCTGGAGTATGTAGCAATCTTTAGGCTTTTATTCCTGGGGGGGGTGGG
AGGGGATAGGAGGTAGACCGGTGAGTGAGCTCAATCTGATTTACAATTCAGGCCTGTATT
GATCATCTATTGGTAAATAAACAATGCCTTGGTCACTGTCACAGTCCCTATAAGGTAATG
ACTGGGAATATGGAACAAGATTATTGTGGCTAATTCTGTTGCCATTCATCTTAGCTGTTG
ATGAAGATTGTGAGGAGGGAGACCAGAAGATAATGGACAACGATACAGCAGAAGGGTCTG
GTAAGCTCCGTTTAGTTGCACTACCCGGGGAGACCTGAGGCATGTTTCCAAGGGCTGTGG
CTGCCTGTAGCCATGGGATCTCCAACTGCATGCCAGAGTAATGGAGAGACTTTGACAGCT
CAGGTCAGCACAGTGCCTGCAGCTGCCACTCATCTTTCCTATATATGTATATCAGGCCTC
AAGTTGAGCGCCCTCTACCTGTGAGGCTATTGTTCTGTGGTATTTACAACAAATGTTTCT
TCTGCAGGTTACACTTGAGCTTATTTCTTGGAAGAGTCTGAGAAGACGGCCTGTCAGGCT
CCTAACACTAAGGTAATTGCTGGCTAAGACAGCCTGACCCTCCGGTTTCCCTTTCCCATC
GGATCTTGACGCTGGTCTTGGTGGTCGTTAAGGAGGAAGAGCACCCTGAAGCTGGCCTCA
CAGCGATGCAGTCTGCTGTAGAGCAGCAGGCCAGACTCAGACATGCCTGGGCTTTGAAGT
GGGAAAACTTGAGAACTGATCAGTATTGCTGAGTAATGGCTTACTTTCATGGTTTTTTTT
TTTTAAGGGCCATGTAACCAGTGAAGCAGCCATTATATATGATTTGGTCTACACTTGTTG
GGTAAGCTTAAGGATTGTTAACCCTTTTCCTAAGTAGTATAGCAGAAATTCAGGTTTGCA
TAGTGGCTAGCCATCTATAAGCCACCTCCATAATTTATGTCTGAACTAGTTAGCTGTTCA
CATCTGGGGCAAAGATGTGTGCCATGTTGGCTGGTATTTGTCAATTGAACATTGCATGAG
TACAGACACTGGTCCATGATGAAACCCATTATCAGTGGACATCTATGGATGAGAAATGCG
GATATGGGACTGAGACCAGTTCTTAGGAAAGCCTGAGTTGGGGAATGAGCCTGAAGGTGG
AACTAACATAGACTTGCACTTCCTTTTCAGAAAAATTCCACAAGAGGATCTCCTGGAAGC
TAGCAGAAGTTTTTGGCTTGTACATTGCCAGGCAGCCATTGGAATCGGAGCTGCAGTCAG
ATTAAGGCCAGCCTGGCCTACATTGAGAAACCTCATTTTGGGAAAGTGAAATACTTTGTC
AATTAACATGCAGTTGGTTCAATAAAGACTTTTGGAAAGTGTCCTCTTTTTTATTTATTT
ATTTATTTATTATATGTAAGTACACTATAGCTGTCTTCAGACACTCCAGAAGAGGGAGTC
AGATCTTGTTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGACTCAGGATCT
CTAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTCTGTAACTGAATT
TTAAGTGGCAGCTTGGTCTGCTGCATTGTGAGTTCTAGGGCTGCCATGTCCTACCATTGG
CCAACCATTAGGTATTCTGGGGTTGGAGTTTTTTTTTTTTGATGAGCACACCAGGATCAG
GCAGGCACGGGAAGCTGTTAAGGCCTGTTAACCTATGGTGGGCATTCTAATTAAAGCCAC
TAGTTGCTTAGCATTGACAGGCTAGAACTGCTAGGGTACTTAAAAAAATGTCATGTGACT
CATCTGCTTGTAAAGTAACTTCTATGGCTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTTT
CCCAAGGCAGGCTTTCTCTGTGTAGTCCTGGCTGTCCTGGAACTCACTCTGGAGACCAAG
CTGGTCTCTAGAAGATAAACCTATGCTATCTCTCCAGCCCTTTTTCTTTCTTTTTTTTTT
TTGGTTTGGTTTTTTGAGACATCTCAGAAATCTGCCTGCCTCTGCCTCCCAAATGCTGGT
ATTAAAAGCTTGTGCCACCACTGCCCACCATGACTTTCAATACAGTTGAAGAAGCCCAAT
TCAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved