Mus_musculus Locus Mono:446:SNORA42
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:446:SNORA42
Mus_musculus
Mono:446:SNORA42
11
SNORA42
1001..1115
2115
CACATGGTGGCTCACAACCATCTGTAACAAAAATCTGATGCCCTCTTCTGGAGTGCCTG
ATGACAGCTACAGTGTACACACATTAAATAAATAAACAAACAAACAAATAAATAAATTTT
TTAAAAAAAGAAAAAAAAAAAAAGAAATTTAGATGTAATTTTCACCATTAAAAAATGGTA
ATTATGAGGCCGGGTGTGGTGGTGCACGCCTTTAATCCCAGCATTTGGGAGGCAGAGGCA
GGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAGAGCTAGTTCCAGGACAGCCAGGG
CCATACAGAGAAACCCTGTCTTGAAAAATAAAAAACAAACAAACAAAAAAAAATGGTATT
ATGGAGGCTGGAGAAATGGCTTTGAGATTAAGAGCATTGGCTGCTCTTCCAGATCTCCCA
AGTTTCATAATTCTCAGCAACAACATGGTGGCTCACAACCATCTGTAATGACCTGATGCC
CTCTTCTGGTGTGTGTGAAGACAGCTATAGTGCACTCATATACATAAAAAAAAAAAATTT
ATGGTCTGAGGTCAGCTCTTTTCTTCCACCATGTGGTTCCAGGGACTGAAATCTGGTCAC
TCAAACCCCTGAACCATTTGACTGGTCCTAATTTGTTCAATTTTGAAAGTATTACCTTAA
TTTTCTTCCTAATTTTCTTCTCTGCCTCAGCTTTCATCTCCACAGTCACTTGGGGGATGA
CTCTTTTGCCCCGAGGAGAAGGCAAGACGTCAGCACACATCTGTGCTTTCTTCCCCTTTG
CTTTCCCCGCCTTTCCAGGAAGGCCCACTTGTTCATCCTGCTTTTCCTTGGCCTCGACAA
CCTATGAAAGGGAAGAGTGAGAGCAAATGTGCAGTGGAGAAAACACAGCACCTGAAAAGC
AACAGTTAAGCAAGCGTGAGAACTGTATACAACGTAAGGTAATTTGGTGGTCAGCCTCAG
TGGAGATCCAATAGGGCTTACTTTGAAAAGGCAGAAACAGTGCATGGGTTTGGATTTACG
GCAGGCCCGTTCCCCTGGGGATCGCATAGTGTTCTGTGCTAGAGCGACCCGTGGCCCCGT
CTGTAGGCTGCTGGCACTGAAGTGGGTCACACAGTAACAAAAGCAAGAAAAGGCAGAAAC
AGAAGAATGGAGTGCTTACGTCTAATCTCACTCAGTCTTTCTGAAACAAAGAGGAAGCCA
TGCTTTAAGGTAAACCATATAAATGTGTGTGTGTATTCCCGATATTAATTTTAGTTTATT
TCTTGCCATCATTTGCTTCATACTATTATTTAACAACTCAATTTTTTCCTTCTCTCTTTA
AAAGTACATTATCATTACTGGATGGGTGTGTGCATGGTCATGTACACATCACAGCAAGCA
TATAGAAACCAGAGGATCACTTTGTGAGTCGCCTTTCTCCTGCCACCTTACCTGGGTTCT
GAGGATTGAACTCAAGTTACCAGGCTGTACCACTCTGACTGTCCTCTCTGCTTTTGTTTT
TTTGTTTTTCCCTTTTCTTTTTCTTTTTTGGTTTTTTTTTCGAGACAGGGTTTCTCTGTG
TAGCCCTGGTTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCC
ACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCGTTGTGCTACCCCAGCCAGGGTTC
TCTTATGTTCACCCAGCCATACACTATGTTATTTTTTGAAGTGCTAAGCATAGAGGGCAA
AGGTTTATACCTGTATGGAAAGTGCTCTATTAGTTAGTGCTCTATAATTACATTATCTCC
TAGTCCTTGGTTTTTGACATGGTCTTACTAATATAGTTTAGTCTGGCCTTGAACTTACTG
GGTAGCCTAGGCTCCTCAGACTTGTGATGTCCCTACCTTAGTCTGAGGGCTGACTGTCTA
CGTGGCTACCAAAGCCAGCCTTTTCATTATTTTTACATATTTTGTCATATATTCTTTCTC
TTCCTGTACTTTTTCATAAGAAGGTATGCTGCTGTGCTGGACGGATGGCTCAGTGGTTAG
GAGCCCTTACTGCTCTTGCGGAGGATGAGTTATGGTTCTTAGCACCCACCCTGGTGACTC
CTAACTGACTGCAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved