Mus_musculus Locus Mono:401:SNORA73
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:401:SNORA73
Mus_musculus
Mono:401:SNORA73
12
SNORA73
1001..1207
2207
GATTTTAAATTCATCACTGAACATCATTGAACATAAATTTGGAACAGGACAAGAAAACA
CACATGTCCTCAGCAATTGTTCTTTCTGAGTCCTAGGCTCAGCAAGAATTTTTGGCTAGA
TAGGGAATAATCAGCATGAATGCTGACTTAGATTTTCCACAGGAGAATCCTGCAAGCAAA
GAAAAGACAAGAAGCCTCCATCAAAAAACATTTGGTCTTCAAGTACAGGAAGGACACTAA
TCAAAGGATAAATAAGGAGTCAAAGAAGATGTTACAGAGAACGACAGAACTAGAACAATG
AAGGAAGAGACAACAGCAGTGTTAAGTCATGGTGAGATTGTGGATGAGTTAAGCTCTGGG
ATGCTTCCATTATTATTTAAATAAGGAAGACATGTTCAAGGTGTGATAAAGCCAGAGCTG
ATTTTCTCTATAATGATACATATTTCATTAAATGTAATTCACATAATGAAGAAGTTTTGT
TGTGATGGGCACAATAAAGTGCATCAATAAGAACTTTTTAAAAAATGTTCTTCCTTCCTA
TGTTTGCAATACTTTCTATATTCTTTTGCTTATTGGTTCACTGATAGGGCAATTGCTAGC
TTTTGATGGCAAATGAGAACTTCTTATCAAAAAGGTATGTGACTGATGTGTTCTTTGGTA
TGGTTCTAGTTCTGAGACTTCACAGTAGGTACCCATTGCTCTAAAAGAAGTTTGAAACAA
TTGTTCTTGTGTTTCCTTCTGAGAGTTTATAAATAATTGAAACTTAAAACCTTCTTGTCT
ACTTTCCCTTTTTTACCCAGGGAAATCTAGTCATTCTCATTAGCATCAATGTATTCTATT
TAACAACTTAATTCATTAATAAGTGCAAAATTAAGGAAACTCAGAAAATAATCTAATGAA
ATTCGGAAAATAAGCATAAATAATACAAATGTTATGAAAATGATAAATTTTAATTATACT
GCTTAAATTTTTTTACATGTGTGTTAGAAGAAATCTTAGACTCAACATGGACACCCTGGA
GGTCATTCATTCTCCCGGAGCTCTCTCCTAGTGGCATAGTGAACCACAGGGCACTGCATG
GTGATATAAAGTTCCTTTCCACAATGTTGGAGATGAAGCTGGACTTCAAGTCTGTGCCTT
CATATCCCTAAGACTTCTTGGAGTCCCGTGGATGATGACTAAGGAGAAAAGCCATGCATA
AAACAAACAAACAAGCAAAAAAACAAAAAAAAGAAATCTTAGAAAAAAAGCAATATACTA
GGACTCCTGGTCATAAAGACTTCTTTGAACCTCATGGTATAGAATTATGAGAAATATGCG
GCTTCACAGAAACAAAATCCATTTTTCTTCACAGGATAATATGAATTTCATCTCATCAAT
ATGGAGAGAAATGCCAACTTAATTTTTTGATTGCTATGGTCTATAAAGTATAGCGAAAAT
TGCATTAAACATCTCCGAAAAAGCTGAATATATCAAAACACAATAAAATATTGCTCCAGA
GAATGTTTGGCATTTGACTTCATTATAGTAATACTGAAAGAAAAGATACTTTGGGATGTC
AGTTTTCACAATAATATTTGATATCTTTGTAGAGCTTAACAACTTATGAAATACTTAGCC
ACATATCTCACATAGGCTTCAGAGAGATCTTGTGACTTAGACAAGTCAAAAATAATAATT
GTTTTCTCATAGATATAGAAACTCAAGTGCAGGGTGATTGTGTGTTTTGTATAACTTCAC
TGGATGCATTGAGTTATCCATTTGGAAGAATTTTTCAAACAAGCTATAAATTTTCCACGG
AGGTGCATGTCACTGTTTTGGGAATTCCTTTCAAGTGAAGCAGTAGGGGCTCCCACGGGA
TAGTTCACAATTCAGTGCCAAGTGGTCTTCTGTTTTTGAAATTCTGCTCTAAAATGAACC
ACACAAGTATAAGGTCTCTGCATTAGTGGGGCACTAGCGGAGCAGCCCCTCATGCCTTCC
ATATAGCAACCCAATGCAAAGAAGAGATTTGGGGCCATAACCCGATTACTCCAATCTTAA
AGCTTCTGAAATCATAAATCCCGTAAGAGAACCAAATTTCAGTAACCCTATGCTGTCTAA
TGGAAAGTCGGGGTTAATGTCTCTACGTATTTTCTAAACTAGTATATGTGAAAGTTTAAA
TATAAAGAATAAATGAATAGACCTCTCTAGCTGTTTTGTTTGTTAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved