Mus_musculus Locus Mono:483:SNORA76
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:483:SNORA76
Mus_musculus
Mono:483:SNORA76
4
SNORA76
1001..1135
2135
TTCTTCTCATTCTCTCTCTCTTTAAAACCATACAAGACCGTTATGTATGACTTTTGACT
TGCAGTTAAGTGTACTAATGTATTTACTTTATTTATAAATATATTTCTTCTTCTCATTCT
CTCTCTCTTTAAAACCATACAAGACCGTATGTATGACTTTTGACTTGCAGTTAAGTGTAC
TAATGGGATTCCTGAGTGTTCGGGTGGTGGGTCATTATTTGTGTATTTGCCTTCTGTTTG
CTTGTTTAATCCTATTCCTATGTGCTAGTTTTTGTTTTATCTTATTATCCTGTATTTTGT
TATTATCTCTTAGAAGCTTGTTTGTTTTTTAATGCAAGACAGAAAGAGGGTGGATCAAGA
GGGGGAGGGTAGTAAGAATAGAGGAAGGGAAACTCTAATCAGGATATATTATGTAAAAAA
AAAAAAAAAAACCTTTCAGGAAAAGGAAAAAAATTCATCATTTGAGTCAGCTATATATAA
GAAAGGAATGTTAATTATAACATATTGTGTTTTAAGCTATATACAATTAAAAACCCATAT
GCTGACAAATCACTAAAAATTAAAAGGTGAACAATAAACCATGAAATTTTGTTTGTCAGA
TATAAAATTTAAGACAATGGCTTTATTTTATAAATAGTTATGTATGATGATAAGCAAAGG
TATAGGGGTGTTTCTGATGGTGTCTTGTCTTGTTCTCCAATTGGCTCACGATTTTGTCAG
TAAAGAAGTCATAGGCCAATTGTTGAGCAGAAGGGATAGGCAGGACTTCCAGGTCTCTGG
AAGCACGTGTAGAGATGAAAGGAGAGGAGAGTTCTTAATGCTTCTGATGGAGAAAAGTTG
ACCATGCATGTGAGATTCCATACGGCGTGGCCACACAGGCCACTCCTACAGGTCAGGGGA
TAAAGTTTAAGGCAGGTGGGAAGTGTGGAGCTAAGAATATTGATAAGGGCATACTAGCCA
TGGGAGTTTAATAACGCTCAACAATTGTGCCAAGAAGACAAGTTGAAAATGAACAACCCG
GCGGCGCACCTTCTCCTGGTGCTGGGGCTTAAGCTGTGGCGCCACAGCACATTGCAGGTG
CATGACTGGGGCTGTCTGCCCTTCGCAGGCGGCCCTTTTAACTGCCAGCTACAGACCCAG
AAAAAAAGAAAAGGAAAGAAAAGAAAACAAAAGAAGAGAAGAGAAAAGAAAAGAAAAGGA
AAGGAAAGGAAAGAAAAGAAAAAAAGAAAAGAAAAGAAAAGAAAAGAAAAAGGAAAAAAT
GAAGATGAGCAAGCCATATGTGTCTCTTTTATCCATGGAGTCAAGGGGAGCTGGATTGGG
CCGGTAGCCCCACCCACTCCCAGAGCTTAGGTGGTGTAGAGAAAAGCTACACACAACAGA
AAGGTGTACGCATGGACACTTTTTACAAAATGACTACCAAGCTTACACATAATCAAAACA
ATAAAACTATTTAAAAGCCTTTCTTACTCTTGAAATGAAAGATATAAAACTGAGAACTCA
CGTGACTTCGAGGAGAGGGCAATTTAGGAAATTCTATTGGAAGTTAGTTTGACAAAACGT
ATGACGGACTTAAGGAAGTTTACATCTTTTGATCCAAAAACTCCAGCAGGAGACGTTTCT
CCTTAAGAAGTCCCTGTGAGAAACATAGGAAATATTTCTATGCAATCAATCCCATGACAG
AATGAGTCACAGTGCATACAATATGGGGGGGGGGGATGTTCCCTCCAAAACCTTATTGCA
AGAGAATGGTTATTACAAATTATGATAAATTGAAAAGCATAAAACCATTTTCTCTGACAA
AGTCCGACATGTGAATTATGATTTTACTTATGTAACATTTACCTGTTTACAAACACACAC
ACAGACATGCTGGAAAAAAATTCAGTGCTGACTTCTATATTGTGGGGTGATGAGTGTTTT
TAATTATCCTTGTCTAGCTGTACTTTCTCCCATCCTGAGGAATGAGGAATGCGCATTTCC
TTATAAGATTAAGAAAAAAAATTAAAGTTAATTTAAAATAATAGTATCCAGCAAAAAGTC
ATAATTTTATTACTGTGAAACAATTGAGCAGTGAAGTGACCGCTTGTTATTAATAGGAAT
AACCATCAGTCAGCACCAAGCACATGCAATATTCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved