Mus_musculus Locus Mono:164:SNORA73
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:164:SNORA73
Mus_musculus
Mono:164:SNORA73
14
SNORA73
1001..1200
2200
ATCTCTTCAGATAAAGGCTCCATGTCCAAAGAGCAGGAGTATGCCAGCTGCCAGGGTTT
CTCTGTATAGCTCTGGCTTTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCA
GAAACGCCTGCGTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCACCACCATGCCCGGT
TAAGCACGTCTTCTTGAGCAAGAATGGCATGTCTGGGGTTGGAAGGGAACTTAAAGATCA
AAGAAGCTGCTATTTACTGAACACTTTCTCCAGTGCCTTCAAGAACATTGTAGCGATAAG
TACAGCTATAGCTACTTTCTGAAAACAAGCTCACAGAATTATAAGAAGCCAAGGAAACTC
CTACAGGAGAGGGCAGGAGCTAGCTCACAGCTGCTCATGAGAAGACCTTATTAAAATTTT
CAGAATCTTATAAACTACTTGACATGCATCAATGACCTGAAGTTGGTCACAGTGGGGCCT
TCACACCACAAGTACTGACATACACAAGTGTTCCAAACTAGACTTTTTTCTATGATTGTA
AATTAAATATTTTGTTTGTGGATTTCAGAGATGGCTCAGTGGTTACTAGCACTTATAGCC
TTTACAGAGGAAAGAAGTTCAAGTAATCAGCATCCACATGATGGTTTACAAACATCAATA
ACCTAGTTCCAGGGGTTTCATGACCTCTTCTGGACTCCACATGATCTGTCACACATGTAG
TGTGGGCACACACATATTCACATAAAAATAATTTAAAAAAACCTTTATGTTGCTGCTTAT
ATTACTAATGCTAATCACATTCCCCAAACTGCTTACACAACTGTCTGCACATAGCTTCCA
AGAACCTGCCCCCAGTTGGTTCAGATTGGTAAATAAAAATGCCAATAACCAATATCTGGG
AAGGACAGACAGAGGTGGGTTTTTGGAGTTTCCCAGGCTTGGGATCAGGAGGAAAAGGAG
GGAGAGAGGATCCAGTGTGGAGAGGAGGAGAGACATCATGCCTAAGAAGTACAGGAGGTC
ACTCTCCCGGGGCTCTGTTCTAGTGGCTTGTGGGAGCTTAGGGCATCGCCCAGTGATGTA
CAGTCCCTTTCCACAACATTGGAGATTAACCTGGGCTTCTGAGTCTGCGCCTGCATATTC
CTATGACTACTTAGCATTCTGTGGACAATGACTGAGGAGACAAACCATGCAGGAAACAAG
GGGGGAAAAGCACAGGACAGAGAGACATAGCTGCCATGAGATGGAGCCAGGAGAGTGAGG
CCCAAAGGACTGCCCAACTGGGTCAAGGGATGCCAAGATAAAATATAGAATTTAGTCAGT
AATAACTCAGAATTATCTGCAGGACATGATTTAATCACATGGAAGTTAGACAGTGGCTCA
GCTATTGTGCCGTTTAAGGCATATCAAAATATAAAGGCCTGTGTGTGTGTTTCATTCTGG
AATGTAAACCATTGAGGTGGATAGTTAACATGCTGTCTGGATTTATTAATTAATTATTTC
AACATTCATTTTGATATTTATCAGTAGACTACAATTGCCCATATCATTACAAGGCGGAAA
GCTCTCTAGGTCTAGGTAAAACACATGCACACACACTCATACCCACTCATGAATGACTTA
GGAATGAGGTACCTCTGAGTGTTGTGGCAGAATGAAACTGCTGCACACCATAAACAGAGA
TCAGTTGCTGTTTAGACACCTTCTATTACTGTTGCCTCTGGTGTGCCAAATGTATTCTCT
TCTTCTGTTAACTGTAAAACTAAGCAATTTAAAATTTTGCCTAGAATCAAAAATGTTTTT
CAGAATCTATTTATCTCTTCTAATTTTACATGTTTGTCTAACATGAAAAACGCAAAAGCT
ATAACAAAGACCATTATTGTTTTGTACAACTGTGATCTGAGAACTGCCGGTCCAGACGGA
GAAAAATGATGATGGGTCAGTGACTATGCTGATGTCCAGTTGGCAGCATCACCATAGCAT
GGCTCCCACTCCCGTGGCTCTCCATTCACATACACACACACATACACACACACACCTCAT
TCACAAATATATACACAGGTGATGCATATACAAACACACATGGACATAAACACACCACAC
ACACACACACACACACACACACACACCTCATTCACAAATATATACACAGGTGATGCATAT
ACAAACACACATGGACATAAACACACACCACTCACAAACAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved