Mus_musculus Locus Mono:109:SNORD30
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:109:SNORD30
Mus_musculus
Mono:109:SNORD30
1
SNORD30
1001..1069
2069
CTTCACCTAGACAAGAACTTAGCTATCCTCTTTCCTGTGGACCAGTAAGTCCAGGCAGA
AAACATCCAGGAAATCTGGGACACTATGAAAAGAAAGAGTATACAGATAAGAAAAATAGA
GGAAGAATAAATAATCCAGGTCTGAGGCACAGAAAAATGTTTTCAACAAAACCATAGAAG
AAAATATCTCTAACATAAAAAATGAGGTTTCTATCAAGGCTGAGAAGCATAGAGGATACA
GAATAGACAGGATCAAAAATGAAATTCCCCATGGCACTGAACATACAAAGCAAAGAAAAA
AATATTAAAACCTTCAAGAAAAAAAAAAAAAAAAAAACAAGTCACACATAAAAGCAGAGC
CAAGCCAATATACACATGAAAAGATGTTCTACAAACTGCAAGAGACCACAGATACCAACC
TAGATTACTACATCCAGCAAAACTATCAATAACAGTACCCAGAGGGGAGGAATCATTCCA
TGATGCAATCAAACTAAACAATATCTATCTACCAACTCAACTCTTCAGAAGGTGCCAGAA
GGAAAATTTCCATCTAAAGATGTTAACCATACTCAAGAAACAAGACCAAATACAACCAGA
CTACTAAATCAAACAAAAAATAACAGGACTCAATAAACACTGCCCATTGATACCTATTTC
CCAGTAAAATGATATAGACTAACAGATTGGATTAAAAAGCAGAACCCATTGTTCTGCTGC
ATCCAAGAAATAAATCTTAGCATAGAGGTTAGATATCACTTCAGGGTAAAAGGACTGGAA
AGGGTATTCCAAGCAAATGGACCAAAAGAGTAATCAGGAAAAAAACATCTTAATACATGA
CAAAATAGATATCAAACCAAAAATAACAAAAAGAGATGGGGAAGAAAAGTATTTAATTTT
TAACATACATGCACAAGCACAAGGGCACCCAAGTTTATTAAAGAAATTGAGAAGAAAATT
AAAATCCTTTTGAATTGGATGGACATAAAAACAGAAGATAAGTATATGATGACTTTCATA
GAATCTCTTTTGGCTGACGATGGCTGTTGAGACTTGGATAAAAAAATAAAAAAAAAACTA
TGGAACATGATAAAGGCAGTTCTAAGAGTCAAGTTCATAACACTATGTTTCTATTTATAA
AAATTGAAGAGATCTCATATTACCAACTTAATGGTATACCTGAAAGCTCTAGAACAAAAA
CAAGAAATCTCTCTCCCTCCTCCCTCCTCCCTCCTCCCTCCTCCCTCCTCCCTCCTCTCT
CTCTCTCTCCCTCTCCCTCCTCTCCTCCCTCCTCCCTCCTCCCTCTCCCTCTCCCTCTCC
CTCTCCCTCTCCCTCTCCCTCCTCCCTCTCCCTCTCCCTCTCTCCCCAGAGTATGTCTGT
CTGTCTGTCTCTTTGTCCCTCTCTAACATGCACACAAATACACATGCACCAACAAATAAA
TGGCATGAAATATTGATATTAAATAGGAATATAAATCAAACAACTCTTTTTGCAGATGTT
AGGATTTTATACATTAAAGATCCTAAAAATCCCTACCAGGAAACCTTTACAGCTGATAAA
CACTTTGGTAATGTAGCAGGATAAAAAAAAAAAAAAAAATGACACAGCAATCAGTAACTT
TCTTACAAACGAACATAAATGTATCTTTTCTATATAAAATATTTTATTTACAAATAAATA
TACATATGCATATATCTTGGGATGACTCTCACTAAGCAAGTGAAAGACTTGCACAATAAA
TTCCTTTTTTAATATTTTTATTATTACGTATTTTCCTCAAATACATTTAGAGACATTGAA
GAAAGAAAGTAAAGAATACCTAAAAGGTGGGAAATCTCTCATGCTCATGGATTTTCACAT
TGATACAGCGAAAATGGCCATCCTACCAAAATCTATCTGCACATTAATACTATCCCTGTC
AAAATTCAAACACAATTCTTTGGAGAAATTGAAAGACAATTTTCAGTTTCATATGGAAAC
GCAAAATACCCAGGATCACTAAAACAACCCTGCTTAGCAAAGACCTGCTAGAAGTTTCAC
CATTTCTGATTTTCAAGTTGTACTACAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved