Mus_musculus Locus Mono:7:SNORA74
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:7:SNORA74
Mus_musculus
Mono:7:SNORA74
18
SNORA74
1001..1196
2196
CATTACAGATGGTTGTAAGCCACCATGTGGTTGCTGGGAATTGAACTGAGGACCTGTGG
AAGAGCAGTCAGTGCTCTTAACCTCTGAGCCATCCCTCCAGCCCCCATCAAATTCTTAAT
TCTTCCTTGACTCTGAACCCACTTGTAGCAACTTAGAATAAAGTCACTAACTAAACCTTA
TTTCTAAACTCAGATCAGTTCCCCAGCTGTTGTTGTCCTGTACCCAAAATAAAACTCCCC
TATCTTTGCTCTTCCTGATCCCTCTCTCAGGGAAGATGTGGGCAGCAAGACACCACAGTT
TCCTATTAATCTACCTCTTACAAGGACTCAGTTGAGCCTTGGAATGCTTTGTGTGGGATT
TGGGCAAGTGTTAATGGTGAGTAGTCTTCAGACTAGTGGTGATCAGAGGGTGGTAGCTTG
AAGGCAAAATTGTGTGTGGAGTTTGGGACAAGAGTCATTTCTCTGTTTTCAAATGTGTGG
GACCCAGGGAAGGGCTGAGCTGGTTATTTAAGTGTATAGTGCATTGTTGAGGTACTGTGG
GTTGCTAAAGCTTGTTTCCTTTTTTTTTTCTTTTTTTTTTTTTAGGATGACTTGAAAGTA
GGGTGGTCTTCACCAGGCTAAAAGAAGTAATGATCCATAACAGGGTGCACTGTGGTTCTA
GGTAAGCGTCTTTGTTCTAGCATTGACTGCCAGGCCTGTTGACTACTTGGTCTGCATCAG
GAAACAACTGGGAAACTAAGTTCACTCATGGCAGTTACTGTAGAATTTTAGTGTTTTTGT
TTGAAAGTAGCATAAAATATTTTTGCCATTCCAACCGAGGAATAATTTATAGGAATATTA
TGTGTGTTTCTGTTCACTGCTAGGAGTCTAAGCTTAGTCCCTGCCAAATGCAGACACTGC
TGGATAAAGCTAAAAAGCATAGAAAGTGCTTCAGTGTCTGCTCCCTGGAGTGGTCCTGGG
ATACGTGAAATGGGAAAGGGGGAGAATTTTTTTCCAACCGGTCCAGCAGTTGTCAGCTAT
CCAGGCTGTGTGGTGCCCGAGATCGTGTTACACTGTTGGAAGAGTAAACACTGCCTTACT
AAGGGTCGGCTCCCAGCACTGTTTTGGTGTCTGGTGCTGAGTACTTTCAGGCAGTATTGC
ATCCCTGAGAGTGGAATGACTCCTTGTGGAGTTGGTCCTGGTCTGGGTGCAAACAATTTT
CATGTTAAAAGAAAATGGGACTGGGACTTGGCTATGCATGTATAGGACACTTGTTTTACA
TGTACTAGGACTGACAGCATGTCACCTTTTCCTCCTTAAATTCTAGATCTGAATGAGATC
GCGTTCATCAGGACTTCAGGTTTCTGACAACACTGTTTTGAGTAATGTATATATGGTCTC
TGTAATGTAGAGGTACTTCAGTTCAGATGGGGAAAGTTGAGTTTGCTTTAGAGGATTGCA
GAACTGTGATGTAATTCCAGAGAATGCTTGTCAAGTCCAGCTACGCTTTGGCAGATGAGG
CAGTGAGAGAGCTCACCCATGGCCACTGAGCTGCATATCTAGCTATAATTTTTAGAGGGA
CTAGATGGTGTCTGTGGACTACATGTGGCCGGCTACTTGCTAATTAAAAAGGGATTTCAG
ACATCTATGTGGATGGTAGCCATCTTAGGACAGCTTAGAATGTTTAGGATATTGCTTTTT
AAAAGCAAAGTTTTATATAAAGGTTCCTATAATGGCCCAGATAGTAAATATTAATACTGT
CTTTGGTTTTGCAACTATGTTGCTTTTGTGTGAAAAATAGTGAACTTGGTTTTTTTGTGT
CATCAAATAAATGAACTTGGTTATATTCCAATAAAACATAACTGATAAACACTTGACATT
GGAATTTCATTGGCATTTTCAGAGTCAACATTCCCAAGTATTTGAAAGTTTGAAAATTTC
CCAAAGGACATTGACAAAGAGATAGCAGAATAGGATTAGTAACATTTCTGACTTCTGGAG
TTTAGGTCTTGAGGCTTCAATGTTTTATTTGTTTTGTTGGGGGAAGTTGGAGAGACAGTT
CATCAGTTAGAAGGCCTGGCTGCTCTTCCAGAGGACCTAGGTGGTTCACAACCATCTTTA
GGTTCAGACCGAGGGAATCTGATGGCTTCTGTGGTGCATAGGCAAAACACCAATTCACGT
GCAAATAAAAAGCTTTGAAATTTATATTTGTTTTATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved