Mus_musculus Locus Mono:99:SNORD89
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:99:SNORD89
Mus_musculus
Mono:99:SNORD89
1
SNORD89
1001..1110
2110
GTTTGATTTTTTAGCTACTCATAGTAAAATATGTGGTGAATTTTACTGAAAGAAATGTA
TGACCAGATGAATATGAGCTGTTGAAGTAGAAAATTTTATTTTGAGCACTTTTTAGAGAG
TTTCAAAGTTGGTTTTACAAGTTATCACCAAACTTCATTGTGTTCAGTGCAAATAGGAAA
GCATGAATTAGGTATCAAGTAGATTAGTGCTATGTTTTTAAGACATACCAGAGAAAATGC
TATAATCATTCTAACAGCTAGTCATTACAAAAGACCTTTTTCTTTTTTTTTAATTTTTTC
TTTTTTTCTTTTTTTTATTGGGGGGGGGGGGTGGTTCAAGACAGGGCTTCTCTGTATAGC
CCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCT
GACTCTGCCTCCCAAGTACTGGGATTAAAGGCTTGCGCCACCATGCCCGGCTTTTTTCTT
TGTTTATTAGATATTTTCTTCATTTACATTTCAAATGCTATCCCAAAAGTCCCATATACC
CTCCCCCTGCCTTGCTCCCCTACCCACTCACTCCCACTTCTTGGCCCGGGCGTTCCCCTG
TACTGGGGCATATAAAGTTTGCTAGACCAAGGGGCCTCTCTTCCCAATGATGGCCGAGTA
GGCCATCTACAGAAGACTTTTTCTAAGGCAGGGTCTCACTGTTTAATCTGAGTTTGAATT
CACCATCCTTGTGCCTCAGCCTTTCCAGCAGTGAGATCACTTCAGACTAAGCAGTGATGT
GAAGACTGGAGGTAGTGTCCATGACACAGAACTGACACGGAAGTTGTTTGCTGTGGTTCC
TGCTCTCCTGGCTTTCACTCAGCAGTACTGACTTTGGCTCGCCCAGCAGAGAACTGGAAC
TGTGAGCACATGGTCTCACTCACTTTGCAGGTACTTGTCTCTCACATGCTGAACTGACTG
GGGTCCTGGACCTACTTTCCCAATGACTGCTTCCCATGGCTGCTGAGGAGTGATGACATA
AAAGGCCGAATTGCAGTGTCTCCATCAACAGTTGGCTCTCTGAGCACACGATGACAAAAC
CTCCTGAAGCGAGTCACTGTCTGACCTCAGTGATGCCAGGGCAGAGGCTTCCTGCCTGAG
CTCAGCTTCCCAAGGGGGCATGGGGGCACACAGGAACAGCCCTCCTGTGCTAAGAAAAAG
ACAAGCTACCCTGATCAAGCACTGTCCGTGTACTTTTAGATACACTTAAGGACTGATAGC
TAAATTTGGCAACAATTTCCTTGGGGAAAGTTGATGTCATATGCTCAAGAAAGGATGAGG
TTGAATTAGTGTATCTAGTATTAGGTAGAACTTGAGGATAGTTAGGCAAAAGCAGTTTTT
ACAGATCAGGAAAAATTGCTTTGCCGTTTCCTAAGCACTAGCTGTGGGCCTGAAGTAGAG
ATAGCTTTGTGGCAAAATACAATGTTGTGCTTTTATGATTCAACACATTAGAAAAGCTAC
CTATGCCTTTTCCAGCTCAGCCTTGCTTCTAAAGCCTTAGAAACATTGGTCAAATTTCCA
AAAATAGCATTCGCATCACTCATTATAGTGAGGTCATTGCCATGCACCCACTTGCCACCT
CCTATAGCAAAGTATAGAACAAAATCATGAGTTGAAGTGTCTGTGCCCATTCATTGAAAA
TATGAGGAACAGAAGTCCATCTTTTTGACAAATGATAGGCTGTGTGCTGGGAAAAGCAGT
ATTTTCTGTGAGCCCATTGTATTACAAACCTCAAACTTTTGTAAATCTTGGATGTTCCTA
ATACAGACAGTAGTAACGAGGAACGAGATCAGGATAAAATGAAATCAGCAGTATATGCAG
TTGCTAAGATTTGATGAAAATGTAAAACATTTTTCCTATTTACTGATACCTCAGATACCC
TTGTTACCAAGAGCTACTCAAAGTGTTGCATATACTGTTGCATAGATTGTAAGACACAGG
TCCACAACTAATTAATATAGAAAGGAGTGTGCTACTTAAAATTAGGTGTAAATGAGATCA
TCCCTATAGATTTAGTGGTCTTCTGTAAAGTTGCTTAATTAAATCAGTAATAAGTTAGTG
TTGAATTATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved