Mus_musculus Locus Mono:375:SNORD45
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:375:SNORD45
Mus_musculus
Mono:375:SNORD45
3
SNORD45
1001..1080
2080
CATCAATGTCCAGGCTCCTTGAATGCTAAGGAAAGCTCTTTGCAAACTGAGCGACATGG
GGTCCTTCAGGCAGACTCGTAGCCGGCTGCATCGTGACCGCGGAGTCCTTCAGGCAGGTG
TGCGACCGGCTAAATCGCGGCCGCGGGGTCCTTCGGGCAGAGCGTGGCCAGCTACGTAGG
GCGTGGGCGGCCGGGCGGGCGCGTGTGCGCAGGCGCGCGGGCCCTGACTCCCCGTGCTCC
CGCGCGCTTCAGTCTTTCGGCGGTCGGACATGGTGAGAGCACCGTCGCTGCGGTGCGCGG
AGGCAGGGGTGGTCTGGGCGGTGGGTCGGGCTGCGGGGCATCGCGGGCTCGCACAGCATG
GGGAACAGGCGGGCCTGCAAGGCGATCATTCTTGTGGGGCCCAGGCTGGCCTGGAGCTCT
CCGCAATGCCCCTGCCTCGGCCTCCTTAGGCCATACTTGGACTGCCGCTTGAGCTGTGTA
TGGCTCAGCGTTTTCTGCACTTCTCGAGGCCTGGGATCTTATCCGCGGACCGTGGGCGAG
CCTTCCTGGATTGGGCCGCCTGATATTTTTTCTTAACATCGGGGACTTGTACGTGCCTGT
ATTTTGAAGGTTACATGATCATTTACGAATGTTGTTTCATAGTTAAACATTTTAACTGGG
ATGGAAGGAAGTCGGCCTTGGCCCACGCCTTTTAATCCTAACACTCTTGGATTAAAGAAG
TGAGGCAGAAGCAGGTGGCCTGGTCTACACAGGGAGTTCCAGACCAGACAGGGCTTCATA
GCCGAGACTCTGAATAAAGTAGGAAATTTATTTTGGCAATCGCTTTGACCTACTTATTGG
GTGAGTCTTAGAATCGAAGGTGGAATTTGGAGCTAATGGGTCTGATTATTTAGCAAAGGG
GTTAGCATGTGAAGACTGTAGAAAGGTGCGCTGAAGCCTCAAACTTGTTAAGCAAGAGTG
TGTATTTCTGGCATAACTCAAAAGATAAGCGTCAAGATTCGGGTCAATGATGAGCTGGCA
TGTATTCTGAATCTAAAGTTGATTATAAACCACTTTAGCTCTAGAATTACTCTGAGACCT
GAAAGAAAAAAAGTACTGAGATCTGGCTATGTGTGAGTCTGAGATGTCACGATTTCCGGA
TGGTGAATGGGATCTCTGCTTTTTTCTTGGAAGGGCACACAGCAGAAAGACGTTACTATC
AAGTCAGATGCGCCTGACACCCTGTTGCTGGAGAAGCATGCCGATTATATTGCTTCCTAT
GGCTCAAAGAAAGATGATTATGTGCGTATGATTCTTTTTTCTGTTGAAAGGTTTCTAAGA
CTAACAGCAATAAGTATAATACTTACTTGTATAATACTAATTGAGAGGCCTGATTTAAAA
TGTATTATAGGTGTACCTTGTATATCAGAGGTTGGTATTTGACCACATCAGTCATGTGCT
GGTACATAAAGGGCGGAAGTGCAGGGCTGCAGGTAGAAGGGGTTTGCTCATTTCTGTCTG
GGGTAAAACCTTGAAGGTCAATGATGTGTTGGCATGTATTATCTGAATTCGCTGATGTGT
CATAACACTTTAGCTCTAGAATTACGCTGAGACCTTGAAAAGGTTTTACCTAAACTTGAT
GTAATGGTGTGCCTGGGGAAATGGCCGGGGAGGTTGCCAGCAGCAAGCAGGGGTGGCTGA
GTTTGAGAAGGCCCAAGCTGTGGGGGGACCCTCCAAGGAGGAGTCATTTGGGTAAAAGTA
TTTGTGCAGCAGCTCTCTGTCTTAGAGAGCGTGGCATTTGACTGTCTTTACAACTTTTCA
GTTAGTGGGAATCATAGGCCCAAATGTGTGGCCTTCTTGCCAACTGTGCACCTGGTTCTT
TTGGGTTTGGTTTGGCAGCACGCCAGTGAGGCCTTCACCTGAATAAATGCTTGTGAGGTA
ATGCTTCATTTGGTTCCCATCTTTAGCGTCATTTATCTTTCCGTATTCATAGACTTCATT
TGTAGAATGCAATAATTGATGCTTAGTAAACAGTAGGCATCAATACTGCTTTTGGTTAAT
TCACCTGAGGTTAGCACTTGGAGACTAAGAGTATTGGCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved