Mus_musculus Locus Mono:50:SNORD64
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:50:SNORD64
Mus_musculus
Mono:50:SNORD64
7
SNORD64
1001..1067
2067
CCTCTTCTGGTGCGTCTGAAGACAGCTACAGTGTACTTAGATATAATAATAAATCTTTT
TTTTTTTTTTTTAAAAAAAGCAGTTAAGGGAAAAGAGGAATGGTTCTTGGGATTAAACTT
AGGATTTCAGATAGGGGATTATGTGTATTTACCTGTAGAACAGTCATACTGACTCTAGAG
TAGTGGGTTGTTGCTGTTGGGATATCTGTAGTAGTTTAAAAATGACAGTGGAAATTACAG
AGATGTGGGATTAATGGCATGCATAATTAATGATATCCATATCTTTTAAAAATAGTAATT
TGTTAAAAGCACATTTTAAAAGTTTTTGTAATCATCAAAATGTTCAGTTAGACATAAGGG
TGTTAAATGAATCACTTTGAAGGTGGGTAAAAATACCACAGGGTAGATAGTTTGCTTTGT
TAGAATTGGCTATTTTTTTTATGCTGAGGTTTAAACCCAAGGGCATTGTATATAGTTTCT
TTCTTAGGGTCAAACTGACAAGTCAGGCTGTGTGGATCTGTTTGGTTTCATTGTTTTGTT
TTGTTTGGGTTTTTGTTTCTTTGTTTTGCCTTTTGACACTGGGTCTCATTATGTAACTGA
GTCACACTGGCATCCAATTCATAATATTCCTGCCTTGCTGTTGCAAGTGCTTATTTTATA
GGCTCGCCACACACCTATTTTTTCATTCACTCACTCATTCATTAGTGTGTATCTGTGTGC
CCCCACCCCCTACCGCACTCCAAAGGACATACTTTCTGTTTACCTTACAACTAACTACAT
ACTTAGCCAGGCCAGACTATATTATTTTTAAGCTGTTTATCTAGCTCGGAGTTTTATGTG
AAGCAATAGCTTTGTAATGAACGTGTTCTCCTAAATCTTGAGGTTTTTCTCTAACACAGG
CCTCTAAAACTCATGTTTCTACTATATCAGTACCATGTAACCATATACCACTTTCCATTT
TTACAGTTTTTTTTTAAAGTCCCTTCTGAAGGACTTTGGCTGGACTTATGATGAGCTATG
TTTACTGAGCATGATGAAATGATGCTCAAAATGATTACTCTGAAGTCTAGCCAAAGTGTC
AGTTTAAGAACTTAGGTAACAACTTAAGTTCTGGGAATATGAAACAAGATTTTTTTCAAG
GAGACTGGAGCTGTAGATTTTTCCAATATAGCAAAATTGGTTTTAAACCTATTTCATTTT
ATTTTTGTAAAGTGCCTTTGTGTTTCTAACACCATAGCTTTTTCACCTTTCTTTCTATAT
AATAAATTCTAGAAATAAAGAACTTGGAAGTTAGTGTATCGCTCAGTTACCCAAAATGTA
CCCTGTGTGATAGTTTCCTGAGCATGTTCCTAGCCATTTTGAATGTATTGTTCCTTGATT
TTTTTTTATAAGATAGGAATTTTATGTTTTTTCCCAAATGCTGAGGATAATCCAGAGAGG
TTAATCTATCTTTATTATCATAAAGCATTGATGGAGTAGTCACTCTGTAATTGCCAATAC
TGAATATGAGAAATATTTGGTAAATTTTGTTTAATTTTTTGCTAGTGAGATCACGTACTA
TTCCTGTTTTCAAACACGTGGTTGGGTGGTGTCAGGATAATCATCTGCATACCAGTTTGA
TTTTGTTCCTCTGAAGTGTGAGTTTCCCTGAGCTTTGTATGTTAGCTACTGCTGTAGTGA
TTGCTTGTTGTGTGGTATCCTTCTGCCTTTGTAATACTTACTTCTGGATCTTTGCATATC
TACATGCATACACAGCAATAGATTTATTTTCCTATATAATTATAAAACAATTCTTAATCT
GTTGGTTATGGCAAATTTATTGCTGTGATATAGCTTTGTTTTAAATATATGATAACTTTA
TTGGCATAATTTAGTAAAACATGTGAAATGATGATTATAATATCTTACATGGTTCAGCGA
TAAACTAGAAAGATACTTTTGTAGGACTTTACTTTTTGGTTAATTAGTAAAAATCAGTTA
GATTTTGACCTATTTGTTAGGTTAAGGTGTTTTAAATGGAATGATCTTATAAAATAACTA
ATCACAGGGATAATTTCTATAATGTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved