Mus_musculus Locus Poly:11:SNORD113
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:11:SNORD113
Mus_musculus
Poly:11:SNORD113
12
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1073, 2610..2681, 4204..4275, 5922..5993, 6702..6773
7773
AAGAGCAGATGTAGCCATAGGCATATAAGATGTATATGAAGCACAATGTTTAATAAAAT
TTTACCAAATTAAGATTGTGCAACAATAGAGATAGGCATCAGTGCAGAAGATCCCGTAGA
GGTTTAACTGCACTCACGGATCTTATAGTTAGGGCTTGTCTCCAGTGGAGATTTTCGCAA
TGGTCCTAGTCATCCATTGCTCAATAATTTTACATAGATTAGTAGGGAAGAGGAGGACTG
ATGTTGGATCAATGATGAATGTCTGTGAGCATTCTTAGAGTCATGAATCATGACGACAAA
TTTAATTCTGAGATCAACATCATAAAGTATCCAGTGACAGCTATAAGAAGTAGTCTTCTT
TTATAAGTCAGTAAATGTAAATAAAAATTGACTAGGAAGTCATTTAATCAAAAGGCAGCT
CACAAAGAAGACTACATATATGTATATATGTATATATGTAAGAAGAAAGTGTGACAGAGT
AATGACCATGGAGGTGAGGGATAAGATGAAATGAGCAGAAGCAGGCAGAATACATAGATA
AGCGAACGGAACATCAATCTCTTTATAACCTCTTCTGTCTATACTTCAAGAATGGATATC
CTGCAAGTCGGCTTCGTAGAGTCTCCCTTGAAAGTGGACCTCATGATCTAGCCTTTATGT
CCGTGGATTGACACTGTGTGAGTATCATCAGCGTGTGTGCCATTGTTTATGGTACTTACA
GATGGCCCTATAAGCTAGAAGAGAAATCTTGAGAAAATGATAAACATGGCTATTGTGTGT
AGTACATTGTTAATTTTCCCAAATTTAACAACAAATTAATTTTGCCAAATTTAGTGCATA
TAAATAAATACTCAGTTTGACAAAAGGTCCTTTAGAGATCTAAGTCTCACTCAAGGATCT
TGCTGTTTGAGATTTGTGAGTCATAATTATCTGCATAGTGTCTTTAATTACTCAAAAAAA
AAAACCACATACAAATTAATAGAAAAGAGGAGGGTGCATGTTGGATCAATGATGACCAGC
GGTAGCCGTATGATTCATGGATCATGACTACAGATCTGGGAGTCTGAGTTCCACATCTCA
ATAGGACATCATCCCCCAAGCACTGTTACCGTTATGAGTGCTAGTCTATTTATATAATTA
GTTTAAAACATAGATATAAATTTGTAGCATATACTCCACTTAAGATGTTACTTCTTAGGA
AAAGTTTTAAGGATATATCCCAAGGCATGACTGAGGATACCGTATGAACCATAATTAAAG
ACAATGTTCATGGTCAGATGTAGAGCTGCCTTTTTTCTCAAGAAGCACACATATTAGTGT
GATCTACATTTTGGATAATAGTCAAGGAGAAAGTAGCAAGACAAGCAGGTAGCAGTCATG
GATGTGTGAACAGATTAAAAATCTTTTTTATTATCTCTTCTGCTTTACATTCTCAGGATG
GATTCCCCCCAAGTTCATTTAGATATTCTCTCTTATTCATAAATGTCACGGTCAGCTCTG
TTCTTATAGATACCAGGTGAGTATAGCCAACGTTCTTTTGTTGCTTCATGTTGCTTTTTA
ATGGCTGTGCATATACTGAGAAAAGAAAGTCCAGTTATTATCTGGGAAGAGCATCCCGCT
TAAAGTGTTAAATGGCAGTTAGATGAAACAGAATGTTTATGAGTATTTCCAGAAGAGGAA
TGTATAACAGAAAAGATTCTAATCATGGCAAAAGATCCTGAGGACCTTCAGAGTACACGC
AACGATCTTGTCCTTAGATTGTGTCATTTATTATCATCTTAGAGGCACTAGTGAGATTAA
TTGCTCAAAAAAAAAAAAAAACCATTGATAAATCAATAGAGAAGGATAGAGCTGAGGTTG
GGTCACTGAAGACACACTGTGTGTAGGAGTCTGAGGTCCATATTATGAATATAGTTTGTA
CCCATATTCTTAGACAAAAATGGGAAAGGCTTATGGGAAACAACACTATTTTTTATTTAA
TTGAACATCTTAAATTTTAATTGTCAAGTAATTTTCTAAGTAAGATATCATTCTATAGAA
AGTGTACTAAAATTACATACCAAACTCAGTAGTTAATAAACAGTGGTTAATTGAGCTTGC
CATGTAATGTGTTACTTGGTAGGTTCATAGCCATAGCCATTTCTTTTCTCATAAAATATT
CATTATAGTATGCCATACACTTAGATGAGTGACAAAAAGCACAGGGCTGTGAATGCAATG
GTCTGTAGACAGAGTGTCATGGGTTTTCTTTAATAATTTCTTCTGCTTTTGCTCTCAGAA
TGGATACCCCAAGGTAAGCTATGGTCATCACCTTCACAATCTGATTCCTTACAAGTGTAT
TCAGTGTGCATGTCTTTCTTGACATTGCATCTAAAGATTGGGTACTGTATTGTTGAAACC
CTAGTTATGACCCATTGGTTAATATGACATGTATGTAAATACAATATTTCACAAAATTTT
GCTAAATAAAAATTTATAATATAAGATATGATCAATAGGAGAAAAAATTACATTCAGGTC
TAATATATACTGAAGAATCTTTTTCTTTGATTTTTGTGATTCATAATCATCTCAATAATC
ATTGGGAAGTTGATAGGAATTGGAGTCCTGAGGGTTAGTCTTGACCTCTGGTAGCACACG
ATTTGTGGATGATGGGTACAGGTCTGGAAGTCTGAAGTCTATATCTTTAAACTCTTAGTA
TGAACTCATGTCAATTATTAGGAATAAGCTACAGTTAGATAAAATATCAATAAAATAAAT
CCCTAATTCATGTTCTATTCAGCACTTACTTGCCCAAGATTGTTAAAATATACACCAAAC
GTAATACTTTTTGAGATGTGATAGCTGAGGATGTCACATGAATTAAATTTATTGGCACTG
TTCCTTGTAGGTTAGAATAATGGCCATTTGTTTTCTCAATAAGAACATAGTATTAGAGTG
CATATGTAGATAAGCAATAAGAAAGAGGGTATTAAGACAAGCAAACAGAGAGCATGGATG
AGCGAAGGGACCTCCAGTCCTGGACTTGCCCTAAGTTGATTCTCACTTGGATATAAGCTC
CATTTTGCTCTTTGAGTCAATGGATCTGGGTTGGCTCATGGTTTTTTCACTGACTGTGTA
TACATTGATGAAAAGCAATAATCATTTGAGAGGACAGCCTTTGCCATATGGTTATTACCG
AAAGTGGGTCAAACACAATGTTTAGAGGTTTTTTTGTGTTTTTGTTTTATTTATAATGTG
TAATAAAAGGGGCACTAATAATGGCAAAAGGTATCTGGGAACACTGGCATATACTTAAGG
ATCTTGTCCCTAGATCTTTGTGAGTTATAATTATCTCAGTTGTACTCATAGTTAATGTCT
CATAAGTCAAGAGCAGAGCGGAAGATGATCGTGGATTAATGATGGCCGCTAGTGCTGCAT
GCATAGTGGATTGTGACTATAAGTCTGGGAAGCTGATATTCACATCCTTAAATACTGAAT
ATATACCCATCATTCTAGTGACAAGCTGAGTAGTTTACTTTTATAATAAAAAGTATTAGT
GACTACTAATAAATTATATTTAGATAAATTAGAAAAAAATATAAAAATTGGAATTTATGT
TTTAATCAAGTATAGTAAATGTATACATTTACTATACTTACATTACAAACAGTAATTCAT
TTGAATTTGATATATGAGAATTTCATACTACATCCAAAAGACTATAGGCAATGGTCTTGG
TAGGGTCAGTGCCATGCTTTCTTTTTAAAAAGAGCACACTGTAGCATATTGTATCCAGAG
AGGAGTAATAAAGAGTGGGGTTATTTACAGTAGGCACAAAGTGAATATCAGTCTTTTTAT
TTTCTCTTCTGCTTTGTATTTAGAATGGATACCCCTAAGCTGATGTATATACACCCTTCC
TCGGTTGTGAGATTCCTGCTCTGGTGGTTGTAGTCATAAGATATACATCGTTGCGTACAC
CTTGGTTGTGGGCACGCACACTACTGTTGAATTACCACCTTGTCCAAGTGGTAAGTAAGC
CTCTGCCTCAGATGTTTAACGAGATTTTTGCCATGTAGGCAACATATAATTAAACCATTA
CTATAGGATAAAAGAGCCCGTGGCTGTTGGTCATATACTCAGTGATGTTTTCCTTAGATG
TTTTTGTGATGCATGATCACTTGATAACGATATAGATATTAAAAGAGATAGAGGGGTCTG
ATGTTGGATCTGTGATGACAAAGGGTGGCGTATGAGTTGTGGATCATGAGTACATGTCTG
GAAGTCTGAGATTCACATCATGAAAGATCTAATATATCCTCATGACCTTAGGGACAGATG
TTAGGAACAACCTATTTTTACAAGTAAATTGGCTCATGGTATAAACACAGTAAATAGTTT
CTTCCAGTCAAGACATCCTTCTACAGCAAGAGTCCTACTAATGTAAACCAAACAGAGTCA
CACATTCATACTTGCTGACATTGGATGACACATCAAGTAAAATCAATGGCAATAATTTTG
CCATGGTTAGAGACTAGTTACGTGTTTTCTCAAAAATGATATATAATAGTGTATAGTATA
CTTATATGAGTGAAAAAATAAAAAAAAGTAAACAGGGAAAAAGCACTGGATCAGGAAACA
GAACATCCATACTTTTATAGCCTCTTCTGATATGTTCTCTCAGAATGTATTATCAGCCTA
ATTCATGTGTTGCTGCTCGGGAGTTTTCTGCCCTGCATTCCAAATCTTCCAAATATAGCC
GATATTCAATTCTCATTTGAGTTACAGCTAAAGACAGTTTAATTTATTGATAAAACCCTG
GTTGGTAATCTGGAAGATCAACCTGGTTCAAATAGTAACCATGGCATCTGTGTGAAATAA
AATTTTTAACAATATTTTACCAAATTTAAGAATGTATATGAGATGCTGAAGAAGACAAAA
GATTCTATAAAGGTGTGAAGTTCCCTAAGAATTTTGTTCTTGGATTTTTGTGAATCATAA
TTATTTCAATAATGCTGGAAATATATTGCTTGATAAACATTTATTAATTAATAGAGGGCG
GTTGATTTTTGATTTATAATGACCAGTGTTTGTAGAATTCTGAGTCCGCAGCATAGCATG
TAGCTTATGACCATGCACATGACCGTGGCAGCAGACTTGTATGATCTTCCCCCTCTACTA
ATTAAGGACTAATTCCGCAGCAAGAGTCATCGCAATATATACCAAACCAAAGTCACATTT
ATTTGATAGCATTATTCAGGATGCCATATAAACAATAATGCTCATTGTGTAAGAGAACCA
TGGCCAAATATTTTGTCCAGACATGTACAAGTATAAAGCAGACTTAGCTGAGAGCTAGAG
AAAAAGACGCTAAATACACAGACAGAACTCATGGATGAGTAAACACAATTTCAGTCTCTA
TAATCTCATCTGCTTTGTACTCTCAGGATGGATGCCCTCAATGGGATTGGCACTTTCTCC
ATTGCTCCTGCACTCTGTTATCAGCACTTCGGGTTCATAATGTACACACAGCGTGAGTAT
AGTCAACCTTGTGTTGATTTGGGGTGCTCAGAAATGCTCACACTGTGTTGATAAAGCCGG
CTTATCATTTGAGATGAGAAGCCATTGCCAATGACTAATATGCCATGTGACTTAAGATAG
TGTTTAACAGTTTTTTTTGTCAAATTAAGAGTTAGTTATTTTCCAGTGAAAAGTATTTTG
ATAAAGCTTTTCATTTTATAAATATACTGAGTTAATACCCCATCCAAAAATAAGAGAGTA
ACAAAATCTATACTCAGCATGGCAATATCTTGAATAATATCTTGAATACGTATTTTTAAG
GGCCTTATTCTTAAATCTTTGTGATTCCTAATCATTTCCATAGCAGTAGTGATCACTGCT
TAACAAAGATGCAGACATTAATAGAGGAGAGGAGGCTGATGTTGGATCTATGATGACCTC
TGGTGCCGTATGAGTCGGGGATCATGATCACAGGTCTGGGAGTCTGAGGTCCACATCTTA
AAATATCTAGAATATGCCGATCATCTCTGTGCCAAATGCTAAAACTAATTTATTTCTAGA
ATTAGATAAAATATCAATAAAAATAAATTTGAAAGTCATTTTCTAATCAAGACATAAATT
ACATAACAAGAATACTAAAACTACCTACCAAACAATAGCTCTTTCACACTTGATGCCTGC
GATGCCATGCCCCGTGAGCTCAAATTGGAGACAATGCTTTTGGTAGGGTCAGAGCCATGA
AATAGTATAGGTTATTATATATTTAGGTGGGTGATGAGCAGAGGGGTAATTTCAAGTATT
AAAATGTGTGAATAAATTAACTGAATGCCAATATTTTTATATTCTGTTCTACTTTAAACT
CTCAGAATGGATTTTCTGCAGCTGATTTTCTATATTCTGTTTTCTTCGGGTAAGCAGAGT
GAGTATAATCTTGTTGTTTTGTTTGTTTGTCTGTTTATAGTATTGTTGAAAGTTTTCCTC
TCTTCTGGAAGAAATAGCTTGCCCAGATCATAAATATAGCATCTGCGTGTCAAATTAATA
ATGTGTAAGGAAAGAAATATGCCACAGGGCTAATGACCTGTCGCTCCCCAAATTAAACTA
AAAATCTTGTTTTATTTTTTTGTGATTCACAATTATTTCAGTATCACAATTGATCAGTTG
CTCAATTCACATCAAGAAATAAATACAGAAGAGAAGGGCTGATGTATTTGTGATGATCAC
TGGTGCCAGATGAGTTATGCATCATGGTCACAGGTCTGCGAGTCCGAGGTCCACATTATA
AAACACCTAAATATACTGATCACCTTAGTGACAGTTGATAGGTGTAGTCAACTTTTACAG
TTTAATAAAATACTAAGAAATTGGAGAGAATTTTACAATCCTAATATACAGAAAGAGTAT
ATACACTACATATACCAAACACAGTCGACCTATGGGAAGTAAGAATGCCCCATTTTATTA
AAATTATAATCAGTAATCTTAGTGGAACTGTAAGCCATGACAATATATTTTATTTTAAAA
AATGAACAGTTGTGTAACACATTTAGATCACAAACCACTCACCTTTGTTGACCTTGGATC
CTTTATTTTTAAAATTTTACTTTTTTCACAAGGTATAGCCTGATCAAGGTTTCTTCTCCT
TCATCTCCCCCCAAGTCCTCCTTCACACTCATCTAGCGTTTCCCCTTCTTGCTCTGTCTC
TTTAGAAAACAAAGACTCAAACAATACCAAAACAGACAAACCAAAATAGAGCCAAATCAG
CCAACAGAAAAAAAGAGAGGAAGATAAGCACCTGAAGCTCACTCATACACAGATACAAAT
GCAGACATAGACAACCCACAAAACGCAAAGCTAGAAAATTAAAATTATATATAATTAAAA
TTAATATTATATAAGTATAATATAATATAGTGCAAAAATTAAAAATATAAGTATATATGT
ATGTATGTATATGTGTATGTATGTCTGTATATATGTCATACCTGAATAAGATTAAAGAAA
ATGTCCATGACACTAAATCTTCCAAATTTACCACTGAGTTCTTAGTGAGTTGTCCTTTGT
TGAACAATGAAATAAAAGATTGTGTGTATATTAGAGCCCCTTCACACCCTGTTTTCTTTT
GTACCCTCAGAACAGATGCCTTCCTCACTGGTCACCAGGTTCAAGGTCCCTCATATGTGT
CAGGTGCATAGTCACCAACGTAAGTCGAAGTTCTTGGTTTGAATTCTTTCTTCTGTTTTT
ATAAAGGCATTTCCTAGAATTTAAAGACCATTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved