Mus_musculus Locus Mono:439:SNORD86
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:439:SNORD86
Mus_musculus
Mono:439:SNORD86
11
SNORD86
1001..1088
2088
AATCTTAAAAAAAAAAAAAAACAACTCTCTTACTTGCCACTTATATATCTTACAGACCT
GACCCCTTAAACGTGTAGAATTCACTGCTAACTCTGGGTAACTAGTGTTAGAATTCAGTT
GAATTGTAGCACATTCATTTGGTGATCACAAAGAACTGAAAAATTTATACCAGAAGGGAA
AAAATGTATATTTGCCTATAGAAGTACATGCATTCTCTCAAGAAGATAAACATAAGGATA
AGAAAATTTATTTTCTTTAATACTCTTCAAACCAATCAAAGGCATTTCATTTCACACTCT
ACTACAACCACAAACAGCAAAGGAATGAAGAGAAGTAGTTCTTTTCTTTCTTTTTTTTTT
TTGGGAGGGGGTTTGTTCTGGGGTACGGGAAAGTTTCACTATGAAGCCCTGAGTGGCTTG
GAATTTACTATGTAGAGCAGGCTAGCCTTGAACCCACAAAGATTTGCTTGTCTCTGTCTC
TGAGTGCTGGGATTAAAGGCACATGCCATCACACTAGGCCCCTATTACTTAAACTTTAAC
TTACTCATCTTTGTTTTTGAGATGGGGCCATGCTATATTACCAGGCTGATTTCAACGTCC
TGAACTCAAGCAGTCCTCCTAGCTCCTGACTTCTTAAGTAGCAGGGGCTATAGGCATATG
CACCAGACCAACTAAAATTTTATTTTAAGCAAATGATTTAATATATCATTATATAAAGTC
TCAACTGTGCTAATAAATCTAATGGTCTCTTTAATTACTACTTCATGCTCAGTCTCCTTC
GCAGAAGTAACTGAACCTATAAATCAGATTTTTAAATATGTATGTGCTATGCAACTACAG
AAATAATAGTTTATTTACTATAAATAGAATTATTAAATATATAAAATAATATACCCTATT
GTAATTTGCTTTTATTATCAGTATATTTGGGGGATTTCTCTGTTGATAAATACAGATTTT
TTCCATTCCTCTTAAATAATGCATAATACTTCTGATTAATGGATATTTAAGTCATTTAAC
ATATTTTGTTCTGGACCTATACAGGCCTCTGCTATGGGGGTGATGTTCAGTCCTGGTGTC
TGAGTGATTAAAAAAAAAATTTTATTCTGTACTATTTTGATCTTTCAAACAAGGACATAA
TTACCATCCTTGTAACATATGCTTGTGCCACATATAAAATGTTTTTAAGGGTATATACCA
AGAAAAGGAGCTGCTGAATCAGAAGACACAAGCACCCTCCAGGATGCCACACCAATTTAT
GTGCCCACAAAGAGTCTAGGACAGTGCTTCTTTTCCTATCCCCTTATACCAGAAAGAATC
ATATCACTTAATTTTCCTAACCCAATAAGTGAAAAAACTGTATTTTTTAAAGTTCCTCTG
ATCATTAATGAGGATGGAAATGTTTTATTATAGGTCATTTTTATTCCTTCTTGTGAGTTT
ATTTAATTGTCTTATTAGGTATAGTTCTTATTATGTTTAGACTTTTTTATTTACTTTTTT
AACATTTTTTTAATATGTATGGGTCTTTTGCTTGCCTATATGTAAGTACATTGCATATGC
ACCTGGTGCCTATGGACACCTAAAGAGGAACTGGATCCTTGGGAACTGAAGTTACAGACA
GATTTCAGCTGCCATATGGATGCTAAGAATCAGACCATGGTCCTCTGTAAGAGCAACAAA
TGCTCTTTACTATTGCTCCAGTCCCTTGTAGGAGTTCTTTACATATTCTAAATCCTATTT
GGCTAGATTTAGAATCATCTAGGATACTAGTGAGGTGCATTTATAAGAGCATTTCCAGAA
GATTACCTGAAATGGGGAGACCCACTCAGAAAGTGGTACCAGATACAACTCCAGTGTTGT
CCAGTGGGATGACACAGAATAAAAAGTGGAAAAGAAGAAACCCAGTGTGGAATTTTTAAA
AATGCTTTGGTATATAACTTACTTGCATTTATTTTTATATAAGTCTAACATGGGGGTTTA
GGTTTTGTTTTATTAAGTCTTGTGTGTTTTGTGTATTTAGGTGTTTTGACATGCATGTCT
TGTGCCTGTGGAGGACAGAAAAGGACATCAGATCCCCTAGAACTGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved