Mus_musculus Locus Mono:133:SNORA44
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:133:SNORA44
Mus_musculus
Mono:133:SNORA44
19
SNORA44
1001..1129
2129
AAGCAGAAACAACTACCATCCCTGACCAAAGCGCTCTAAGCTTTTCCCTGATGGTGACC
AGTTTTAGGTCAGGAATGAGATAGTAGAGAGCCAGGAGCAGGAAAACACTAGTAAATCAT
CTACAGTCTTATGTAGGCCCTTTCCTTTTCTCCAACTCCCACAGTGCATAATACAAACAA
GGTGGGGTCATCTTGGACCATATCAATAAAGACAACATCCTACAAGCTGTTAACTAAATG
ATAAATAAATAGAGGCTAAAATTTTAATAATCAAAGATAAGAGTTTCCATAAAAATCCTA
GCCCTCACAGTACATTGTTCCTCACGAGAGAAGTAGTTTCTCATTGAAGTTAGTTTATCA
GTTTTAGTGGATGGGGAGGAGGAGTGTCTTTGTTATAGCAACTGAACCTACATTGTCTGA
CACACTGTGTACTAAATGTATGGCCGCCACCACAAAGATTTATTTTCTGGGACCTAAATG
GATCTCAGAAGTATGGATCAACATATTCAGCATACTGCCTGGCATATGGCAGATTCTCTG
TCAATACCATTTATCTATTATAAGCACTAGACATTCTTGCCATATTTCTTTTATTTACTA
CCTTCATCAACTGCCCATAAGGGGTTAACTGAAACAGAGGGTTCACCTGCTTATATCCAC
TAAATCTAAACAATTTCGGATGTTGCTTTGTCAGGAAATGCAAGCCCCAGGTGTTGCTTC
AAATGCAGTGCACCCACTGACTTCTTTCAACTTGACCTATAATAGTGCATCAAGGCCTCA
TTCCTCTCATGGTGCAAATAAAAGACTGAGGAATTAAGGTCTTCAAATATCTAAAAGCAC
ATGTTTACCTCAAGATGGTAGAGGAAGGAGGGCCACTGCCAAGTTCTAGATCACCCTGGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTAACTTTCTAGGTTAGCCA
GGATTTCATAGTAAGAATCTGCCTTAACAAATAAATGAAAGCAGCATATTTCCAAGGATA
TAGCTTGTTGTGGCTATGGTATCTCCGACTTCATGCCAGGGTAATTGGAAAGACTTTAAC
AGGAGAGATCAACACAGTGCCTGCAGCTGCCAATTGTTTTTCCTATATGTGTAGGGACTG
GGGATCTACGACAAGTGTTTTGTCCCTGGGAACATACAGAGTTTTCATTCTGTAGCTTAT
ATCTAAGGTCCCTTGAAGAGTCTGAGGGACCAGACTTACTCTGCTCATTAAACAAAGAGC
TATAGAACCAGTGAATGGACCAAATCATCTATGATTTGGTCTACAGTTGGAAACACAAGA
GAAGAAACAGAATGGGCAGCAAGAGAACAGCTCTGAAAGCAGAAATTTTGGATAATGCTT
TATAACTTACATACATGTAATTGGATCAATTAAAACTTTTTAGAAAAAAAGAAATGAAGG
GCAATCTAAGAAAAGAAGGGTTTTTTTGGGCTCACAGATTAAGAAGAGATGCAGTCCATC
ATGGTGTAAAAGGTATGGAAGTGGGCAAGTGAAGCAGCTGGTCACATTTCATCTACAGTC
AGGAAGCAGTGAGTGCTAGTGCTCAACTCTACTTATTATCACTAAGACCCTAGTATATGG
CTTAGTGTTGCCAAAGTCACAGTAGGTCTTCTATTCTTAGTTAAAACTCTCTAGAAATAT
CCTCACAGAAATGTACAGTTACACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAG
GTGGATTTCTGAGTTCAAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGAGC
TATACAGAGAAACCCTGTCTTGAAAAACAAAACAAAACAAAACGAAAAAAGAGAAAAAAG
AAATGCACAGAGCTGTGTCTCCTAGAGGATTCTAAATGCAGTTGATGGTGAAGAATAATA
ATCATCACAAGAGCCAACTGTGGTGCTACCCAATGTTCATTTACTTCCTACTTCCTATTC
TGAGACCACTGTACTACATCCAAAATTGAGTAATGACAATCAACTCTCACAGAACTGGTA
AATGGTAACCTGGACTTGAACCTCTGCAGTGTGACCAAGGCAAACAAGAATCCAAACTGA
TGTCTTTCTTGAGGCTCAAGGATTTAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved