Mus_musculus Locus Mono:509:SNORA55
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:509:SNORA55
Mus_musculus
Mono:509:SNORA55
2
SNORA55
1001..1100
2100
GACCATGTAGAGACTGCCATATCCAGGGATCCACCCCATAATCAGCATCCAAACGCTGA
CACCATTGCATACCCTAGCAAGATTTTATTAAAAGGACCCAGATGTAGCTATCTCTTGTG
AGACTATGCCGGGGCCTAGCAAACACAGAAGTGGATGCTCACAGTCAGCTAATGGATGGA
TCACAGGGCTCCCAATGGAGGAGCTAGAGAAAGTATCCAAGGAGCTGAAGGGATCTGCAA
CCCCATAGGTGGAACAACATTATGAACTAACCAGTACCCCAGAGCTCTTGACTCTAGCTG
CATATGTAACAAAAGATGGCCTAATCGGCCATCACTGGAAAGAGAGGCCCATTGGACACG
TAAACTTTGTATGCCCCAGTACAGGGGAACGCCAGGGCCAAAAAGGGGGAGTGGGTGGGT
AGGGGAGTGGGGGTGGGTGGGTATGGGGGACTTTTGGTATAGCATTGGAAATGTAAATGA
GCTAAATACCTAATAAAAAATGGAAAAAAAAAAGAAAAATTCCCCATTAAGTCAAAATAT
AAAAAAAAAAAAAGAAAGAGCTTCAATGCAGATTAAAGCATAGACATTGGGGGACACTTA
GGAAAGGGGGGCATGTGTTTCCCATATGTTCAAATGTTCTTAGAGACTGGCAGAAGCTGT
CAGAGCTCCTGAAGTTGGAATTACAGACAGATATGGAACTTCTAGGAACTAAACTTTGGT
CTTTGGTGCTCTTAATCACTGAGCCACCTCTCCAGCCCCCTGCCCCTATCCATCCCTTTG
AGATATAGTCTCATGGCATTCCAGGATGGACTCGGACTTTCTGGACCCAAGGATAGCCTT
GAACTTCTGATCCTCCTGCATCCATTTTCCAAGTACTAGGAATACTGGCATATGCCGCCA
AGCCCAGCTGGGCTCTTTCGCTGTCTCTCAGTGGCATGGTTTCCGTGTACCTTGTTATGG
GATGTATCACTAAGAACCTTATTGTTTTCACTCAATTCTTTTTCCCAGGCCTGCTGCTTG
GTGCCAGTCTGGGGACAGAGGAAATCCAGACGGGTTGTTTCCATCTGTCCTGAGGTGTGT
CTCTACAACTCTGCCACACTTCTTGAAAAAAGAAGAAAGAGGAGGAGAAGGGGGAGGGGG
AGGGGGAGGAGGAGGAGGAGAGGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGCTTATTGTTTTTAGTGCTTGTACTAAGA
GTTGTTTTCTTCCTTTTATTTATGGGGTGCTCATTGCTAATGTGCAGCCAACAATAACTT
TTAATGGGCTTTTTGATTAATATCTGGTTTCCATTGCCAATTTAGTTATCATCTTCCAAT
ATCCTGCACTGCCTTTGAATCCTGCCTTTAGCAAGCTTGTTTTCTAAATGTAGTCTTACG
TTAAAGACACAGTAAGTCCCTATGCCTTGTGCCCTATGTAAAGTGATCTTTACATTCTTT
CAAATGTTCCAACACTGCTAGAGACTTACATCCCAACCTAAGTCCATAATCCAAATGGAG
CAGTTTTGTGGCTGTGCTCGAAAGCCCTAGGTCACTCCCCCATCACTTTCTTATTAGTCG
CTGTGATGGTTTGTTATATGCTTAGCCCAGGGAGTGGCACTAGTAGAGGGTGTGGCCTTG
TTGGAGTAGGTGCATCACTGTGAGTGTGGGCTTTAAGACCCTCATCCTACCTGCCTGGAA
GCCAGTCTTCTCCTAGCAGCCTTCACATGAAGATATAGAACTCTCAGTTCCTCCTGCACC
ATTCCTGCCTGGATTCTGCCATGCTCCCACCTTGATAATAATGGACTGAACCTCTGAACC
TGTAAGCCAGCCCCAATTAAATGTTGTCCTTATAAGAGTTGCCTTGGTCATGGTGTCTGG
TCACACCAGTAAAACCCTAAGACAGTCGCTTTTCCTGTTGCTGGGACTGAACATCTGACA
CAAGGGGCTGAAGGGAAAAGGAGTTTGTTTTGGTTTGAAATGTAAGGGTTTCTCCCAGTA
CGATGGGGAAAGTGGGGGGGGGGGGGGCAGGAGAGTCAACTGGCTGGTCGCATGGTCCTC
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved