Mus_musculus Locus Mono:285:SNORD86
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:285:SNORD86
Mus_musculus
Mono:285:SNORD86
16
SNORD86
1001..1082
2082
CAGTGGGAACAGGTGGGAGCAGGTGGAGCAGGTGGGAAAAGGTGGAAGCAGGTGGAGCA
GGTGGGAGCAGTGGGAGCAGGTGGGAGCAAGTCGGAGCAGGTAAGAGGCCTTTAGGTCAC
TGGATGACTGCTATGTGTCCCACAGACCAAGGCACATCAGGTCTGAACCCAGCTAAAGTA
CACACCTGTATCACACGACCTAAACCTCTATTCTAAAACTGAAACATATGTACATACTAA
TAATAAATAGAGCTCCTTCCAGAGTATGTTCTTGTGCTAACAACCACACTAGAAGCTAAC
AAGTTTAATTTACATCTCTTTAAATAAAAGGTTCATGAGATAGGTGATTGGTATACACTC
TCAAGTCCAAACTATCTCAGAACAAGATTCTGATGGTGGGAAGGAGTGGAAACACAAGAT
GAAGGAGAAAAAGAAACGCTGCAAAATACTATCTCTGCGGTGACGTTACAACTCAAGAGC
AGTCTTTTCCTTTCCTTTTTTTTTTTTTGAGATGGGGTCTCATACCATAGCCCAAATTGG
CCAAGGGACTATGTACTAAATGTTTGCAAACAGCTGTGTGAGGTTCAAACAAACAAACAA
ACAAACACAGCAGAGACGTTTCCAAGGCCTGCCAAACTCACACAAACTAAAACAGTCTTA
TAACAAAATCCGAGGAGCAAGCTGCTTCACAGCTATAAACCTGCAGGAGTGAGGCCAGCG
TGGCCTGGAGAGCAAGAGCCTTCTAAAAGACAAACAAAGCAAGGGCTGGAGAGACGGCTC
CTCAGGCAAGGGCGACAACATGAGTCCAGTCCCTGGAATCCACACAAAGGTGGAAGGAGA
GAATTAGCTTCACAAAGTTGACCCCTGACCTCCCCATGTGTGCATGTGTACACACACTAA
TACACACACATGCACAAACTAAACCAAATGAAACAAGATTAAAGCCCAAACAGTAGCCGT
CTCCGCCTTGGCTGTTGGTCTGAAGGACTAAACCACTCCTGTGCCTTTCAGAAGAAGAGG
CGGACCTGACCTATACAGGCCTCTGCTATGGGGATGATGGCCAGTCCTGGTGTCTGAGTG
ATTCCCAGGGCCCAGCAAAAAGGGAGCGAGTTTCCAGGTCAGCAAATTGGATGCCTTCCT
TCTCTGCCTCTGGGAGCCAGGTTGGCATGAGCCCTAAAGACAAGGGGTAACACACCAAAA
TATGGACTCAGAAGAGGCATGCTGGGGCTCAGTATGCGCCACCAGCTGGGAATCAGAACT
AAGTTCGCCCACCAACCTCTCAGAGACACACTGCCTCACTGAACATGTGTGCATGTTCAC
ATGAGCCGGCCTGGGGCGCACACCCTGAGACTGAGTTGGATTGGGTCACCCCATTTCACA
GATGCAGAGAGAATCTGGAGAGTATGGGAAGTCTGCTCCCCTTGAGGGACAGAACATGGC
TCTGCGGTCAGACTGCCACTCACGAGTATCAGAGTTTTCACTGTCCCTGGGTGACTTGAC
CCTTAGCAGCTCTGAGCCCCAGTTCCTTTGCATTCACACAGATAACTCTGTCCTTGTGCT
CTGGTACAGTCAGACCATGCTGACAGGGATCAGGCTCAGCGGATGGCTAGAAACTGCTAA
TCTCATCAATGTCCCCAACACTCACACATTTGTAGTCAGTGGAGCTGGGCCATGAAAATG
ACTAGCTCAAGAGAAAACATATTAAGTCAAAATGTGTCAAAATGCTTTCCTAATGTCGGG
TTGAAACAGAAGAGGAATTTTAAATCAACCTTTTTGAGTCTGCTAACCTATCATTAGCAC
CCAGAGAGAGCTGTATCCTTGACTCTGTGTAGAGGTGCGGTGCTCTAGGGCGAGTGACTG
GGAGCTTGCTCAAGGCTGTGTGCACTCTGAGGCTAGATGTCCTGGCAGAAGAGCAGTGAG
CCCAACTCATGGCAACTGTTACAGAAGACTGTGCTGTGGTGATGGTGACACAGCCAAGAG
CCACCACTTCAGAAACTTAATGCTATCCTGGGGCAGGTGAGCCCCTGGCTGAGAGGGAAG
AACAGTCATGTTTGAAGACCCAAGGCCACAGGAAAGCAGGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved