Mus_musculus Locus Mono:516:SNORA2
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:516:SNORA2
Mus_musculus
Mono:516:SNORA2
2
SNORA2
1001..1137
2137
GATGTACTCTTAGCAAACTCCTGGCTTCCACCAACTCAAAAGCCATTAATGTTATCAGA
CAGCATCTGAAACCCAAGACAGGGTTTCAGAGGTACCCCCTCCCCCCGCCGTGGCTCCCA
GTCATATCTTTGGTAAATGCCTTGATTTATGACTTTCTATCTTATATAACTAATAAAATC
TCATATAGCCATTTCGGCAGGGGGACTTGGGATTCGAAGCAACCTGTATCGTGTTTATAA
GCCTCTCGTATTCGGCTCCAGAATAAACTATCTCTTACTCCCTTTGAGCTGAAGGCCATA
TTTTCTTGTCGACAGATCTGAAGTCTTTGAGGGTTTGATGCATGTGGCTGTGAATGACCC
AGCCTTCCCCACTGCCCCGGTGGTGGGAACATTGTTGACGAGGGCAAACGTTCACTGCAG
GGCAGGCCATCTTCCAAGGCCTCCTGCGATATCTCTGTGATTGGCAGGTGTGTCAGCTTT
GATTCAGTATGGCTGAAGGGACTTAACGCTGTCTTGGCTGCTGCTCTGGAACTTGGTTTG
CTAAGTCAAACAGCCACCATCTTGGTCAGATCAGCCGGTCCCTGCTTACAATGGTCCACC
GTGGGCGTGGTGGCGCACACCTTTAATCCCAGCACTCGGGAGGCAGGCACAGGCAGGTTT
CTGTGAGTTGAAGACCAGCCTGGTCTATAGGCAAATTCCAGGGCTATGCAGAGAAACTCT
GTCTCAAAAATAAATAAATAAATAAATAAATAAATAAATAAATAGAGAGAGAGAGAAAGA
AAAGAAAAGAAAAGAAAAAAGAAGAGAAAAGAAAAGAAAAGAGTCCATTACTAGGCTGTA
TAAGACCTGGTGGCATCGTCTTACAGGAAAGGGTGGGAAGGGTCATTGGACCCTCACCTG
AGATTCCAGCCATTTGTATTCAGTTCTTCCCTAAATGCTTGGGCTTCAGGGTGCATAGGC
TGGGCAGGAAGGGTAGTGGGGGGAGGTTAATGGAGGGCTTCTTGGCCCTGAATCCAGGCC
AGCAGTTGGCTGAAGCTGTTGGTTTCAAGCAGGTGCCTAAATAAATGTCTTTCTACCGTC
TGTTGGCCATTTCCGAAATTTGAAAATGTAACAGTCAATTCATTAGAGAGAAACATCTGG
CTGGAAAAGAAAGAAAGAAGACTGGAAGAGCTCCATCCACGCAGGCATGGAGGAGCCATC
GAGTGCACTGGGTACAGACTTCCCGTGTGGCTGCTTTGTGGTCACCCATGCTCACCCTAG
GGCGAACTGTGGAGGTCTGTTGTTGGGACCTTAGGAGGAGGGGCAGACATTGTTTCTATC
ATCCCAGGAAGGAACTCTCTCAGTAGCTTTAGAGCCCACTGAATCTGCAGGATGGAGGCT
GGCACCTCTGCCTTCACTTTGGGTCTGTCTCCTTGACTTTGCTCGGGCTCATACTGGTCA
TACTATTGCCAAGGTGTGTTCATTGCCAAGGAATCAAAGGAATCTGCCTAACCCAAGCCA
CGCCCCCCGGAGGCTGAAGGCCGAGAAGCAGGTCTTTGTCCCTACACTGTGTCTTTTTGG
ATCCCAGGAACAGCAGGATCTCACCAGACAGCACCCCAAGGCAGAATAGTTATCTCGGAT
GGAGGCTGAACCCTCAAGCAGGACATCTTGGTGGATCCAGATGGGGCCCCTGGTGATCAA
TACTTACTGGTCTACCTGGGGTGGGGGACTTGAGCCAACAGTAATGGACAGACCACAGAT
CACCAGGACTACAGCGTTGGGCAGGCCCTGTCCTCAGTTCCTCCCCTACATAAACATAGA
GTTCATAGCAGCACCTGCTAGGCAAACTTGGGGTCACTAGACCTGTTTCCTAAGACCATA
GTTGAGTCTACTATCTCTGCTTCTCACCATTGCCCAACTGGTGGCTGGGTCTGGCATATT
GGGACCTCTGGAGCTGAGGCATTTGTCCCAAAAGCCAGTTATAGTATCTGGGTCAGGATA
ATGTGTGTGTGTGTGTGTTACATGTGCACGTAGAGGCTGAGGCCAACCTTTGATATAATT
CCTCAGGAGCTACCAACCTTGATTTTGGACATAGGCTCTCTCACTGAAATCTGGGACTTG
CTAATTAGGGTGGCCTGGCTGGTCTCTGAGCCTGAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved