Mus_musculus Locus Mono:214:SNORA4
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:214:SNORA4
Mus_musculus
Mono:214:SNORA4
X
SNORA4
1001..1117
2117
TTGCTGTTCCTACTGCCATTCCTGGTGCTTTCTTCCATGCACATGCACCACCTCCACCT
CCACCACTGTCATTATGATGATTGTAATGGACTCTTATCCCTGTGGAACTATAAACACAA
AATAAACCAATCCTTCTACAAGTTGCTTCAGGCATGCATTTTGTATTGCTTATCATAGCA
ATACAAAAGTAACTAATACACATGAAGTTCAGTTGTTACTACTGGTTTTTTTCTGGGTTT
TGTTTGTTTTGTTTTTGTGGCTAGGGACTGAACCCAGGGCCATACATGCAAGGCTCTGTC
ACATAGTTAAAACTCTAGCTCTATTTCTCCTTTTTTGAGATAGGGTCTCAATACAAGTAT
AGCAGTGTATGCCTTTAATTCTAGCACTTGAGAGGCAGAGGCAAGTAGACCTCTGTGAGT
GCAAGGCCAGCCTGGTCTATGAGTTCCAAAACAGCTGTAACTACATAATGAGACCCTGAT
TCAAAACAAACATCCTACTTGAGATAGGGTCTCACTAAACTGCCTTGTGATTCTTCTGCC
TCAGCTTCCTGAGTAATTATAATTATAGACCTAACCTTGGCAATATGAGTTTTTTATTTT
TCCTGTCACGCTCTCTTGGGGGTAAAGGCAAATCACTCAGTACAGTATGCATGCTCTGGA
CCCTGAATTTTTCCACATCTCCACTTAAGGACAGAGTCTCAGGCAATTAGCCATGATCCT
TTTCAGGAAGGCAAGAAAGAAGATGTAGGACCAGAGAACTCTAGGATCTAAGTTCTCAGC
ACACAATCCACTGATGCCACATACAAAAATCCAAAGTTAAAATATATTAAGACTTTTGGA
ACAACAAGCATTGCATTAAACCTCAACTGTAGGGCTCCATGTGACAACAGGATTCACATG
CTCATGAAGCCACCCTTAATCTAAAAAAGGCCTGGGGATGTGGTTTAGAGATTAAATACT
TGTCTAATATGAATGAGGCCATAAGTGTTTGATCTCTAACACCACAAAAAAATGGACAAA
AGTAAAACCATCAGGCTATTTGATAGAATGAGTAAGACCACACTCCACAGTGGGCTATAC
CACTTTGTATGGTTCATTATTATATTGTGGCCTACATTGGTTGCAGGTGGGGAGGAGTAA
AACCAGCTGGATTCATATTGCTAGCCCATGGTGCTATTGCTCCTCTTCTGTACTGCAGAC
ACTCCTGCTGCATACTACCTATTTCACCTCTACCTATGCTGACCAACAATAAATGTTTAT
TCACTTGCCATTTGTGCTGACTACATCCAGCACACAAAAATTCTGGTATTCACCAAAAGT
CCTCAGATCTTCCATCTCCCAGTCTTTTTTCATTTACTATCCATACTAATTCAGCAAACA
TGCAATGGGCTAGATAATTCCTTAAACTAGGGAGGCAGATAAGCCAAAGTTAATGCACTG
TCTCAACAATTATCACCAAGTACCAAGAGTAGTAAATGCTGTCTTACTCAGGGTAGCTTC
CTTGGTGAAGAGAATTAGTATAACATGGAGCACTGAAATTAAGCTGGGCTCAGTGTAGGC
ACTCAACAAATATTTACTAAGTAAATGAGTATACAAATAAATATTAATTGTATGTAGATT
CCTATAGAATGAGCATTCTAGAGGGAAAGAGACAGGCAATGGCAGAACAGTTTCATTAAG
TGCTACAAAGTAAGTAAAACAGAACAATAATTGCCAAATGAATGAGTAAATTTAAAGCCT
ACATATAAGTAACTGAGAAGAAAAGCCTACATAAAAGAAAACTAAGCTATGGACTTTAAA
TATATTATAATATTTAATCTTTATAACAAACCAGAGACACTCTGTACAGCATTGAGACAC
TAAAACACAGAGGTTAAAAGATAAAAAGAGGGCTGGTGAGATGGCTCAGTGGGTAAGAGC
ACCTGACTGCTCTTCCAAAGGTCCGGAGTTCAAATGCCAGCAACCACATGGTGGTTCACA
ACCATCTGTAACAAGATCTGACACCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTAC
TTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAAGATAAAAAGAGGCCGGGTGTG
GTGGCGCACGCCTTTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved