Mus_musculus Locus Poly:18:SNORA71
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:18:SNORA71
Mus_musculus
Poly:18:SNORA71
2
SNORA71, SNORA71, SNORA71
1001..1132, 2458..2570, 4376..4506
5506
TATTCGGGAGCAACTTGAAGCCCGGGTGCCTGTAATTGGCCTTCCCATGGGTACCAGCA
GAGGGGTGGTGTGGAGTTCTGATTACTACTTTTGAGGAGGTCGACAAAGCCACTGTGCAG
AGAGAAGCTCGGTGAGGGCTCGAAATAACCAAGGGCAAGATTCTGGGGACAGTTCTGTTC
CATGTTGCATAGTGGGGATTACAGAGGAAAGGGGGGGGTGTCTATGCTCCGTGGTTTGCT
ACCTGGCAGCTTTTGTGTTTGGGATTCTGGGTGCTTTCCCAGGTAACTGGGTGCTGTTCA
TGTGGCTCACCTGGGCTTATTGTATTTGCAGAAATAACAGCTGGGATCTACAGTGGCCAA
AGAGTTGTCTCCGTCTTGCTACATCGACAAACTGGTGCTCCTGAGTGAGGATTGTGCCCT
GGGATGGGGGATTCAGTTTCTTCATTTATAGTTGGAAGTGGGTGAAGGTGAGGTGAGGCT
GGGTTCTTTGAGGTGTGCCTGCTTGTTGCTGTACCCACTTGGGATCTGTGTCTTGTGTGT
CCTGTGTTCCCACTGTCGCTTCTGTACCCTTCTGCTTTACTCTGGTGGGTGGAGAGCAGA
ATGGAAAGGAGCCAGAAGATTTTGGGGGTCATATGCACCATCCAGATTTCAGCCACTGCT
CTCTGCTGGCTTCCGGGCCTTGTCTGGTTCTTGATTTCCTCATCTGAAAAATGGGACTAC
CTCTGTGACATAAGAGTCCTGTCACCTCAGTTCTGCCAGCTGGGCAGGTTGCATTGATCT
AAGACAGCAAGTGCTGAGCCTACTGCAGGTCTCGTGGCCAGTGCTTATTAGAACTGTCAC
CTCCTCCCGGCCAGTCTTCCGAGCTCTCCTTAAGGAACAGCTGTTGCTCAGTTAGGAGCA
GCCTCTTTCCTTTGTTGGCTGTCTGGCTGTTGCCTATCTGTCCATCTCTTTCCAGTTTAA
CCATTACCCAGCTCTTGGCCATAGTCTTCCTTGCCCTCTGCCCCTGTATTCGAAAGTGAT
TGTGGGCTGCCTGTGCCCTGGTCATTGATACTGCAGGGAGAGGATTTGGAAAGCCTTTCC
CCGTGTTTGGAGGATCCACACTCGTCCTTGCCAAACCCTGGTGCTTTCCCACATTGCCCG
CTGCCTGCCGTTCTGGCACTTCTGGGAAGCAAAGGTAGGGAGCTCAGACGGTGGCTGCTT
CCTTCAGATCCTTTCTCAGCCTCCACACCCAGTTGTCACTTCTTCAGGACACTTGAGACC
GTGTAGAAAATGTCCTGTTGCTTGACTTCTAGAATGCATCTTGCTGTGTTCTGTTAGTCA
AGAGGCAGGGTTCTGACTGAACAAATGAACGATCAAGGGGCAGTCACTTTCTGTAAGGCA
TTGTCGTGTGTCAACTGGGTAAACAGCCTGACAGGGAGGCCCAGGAGGGAGCAAATTTGC
CGTTTTGCCTCCTTGAATTCTTCCCTCATGGCCTGCTTTTGACTCTTGCCTTCGGTAGCC
ACTTCGGAAGCGTTTTCCTCTCCACTCTGACAACAGGCAAGAGTGAGGGTCCAACAATAC
AGAGGAAGTAACGTGTCGCTGCTACTCTTCCATGCCCAGTGCCAGGAGCGACGGTACACT
CCAGAGTGCTGTGCCCTGATGGGCCTTTGAGTGGCCAGTGCAGTGGATCATCAGCCCTGT
CTCCCAAGAGCTCCAGTCCCTTCTCCGGAGAGGAAGTGGGTCCACTGGCAGCTCAGGAGG
CCATAGCAGGTAAGTCATACACTTGCTACTGTTCAGAGGCCTCATCAAGAGATTGGAGTT
TGAGAGAATGTAAGGATGGCTCTGTCCAGTCTGGAGCCCCAGCCTTTGAGTCCCTAGAGT
TTCCTGTAGTATTTTCTGCCTCTTTGGGGGCGGGGAAGATGAGTGGGGAGTGGTGTGTGG
ATCCTCCCACCTAGGTCGTGCATGGGTAAGTGTGAGGCCTTTCCAGTGTTAGTGAATTGT
AAGGGCAAGGGAGTGGACGTAGGCATTGAAGACACTTGTATATGCCACGGTCTCCCTCTT
TTTGTCATTGTGTTGGGTAGCAGTGACTTGTTAGCAGTGGAGGGAAAAGTCATAGTTGAA
CGATGGAGAGTTAGGGTGGTCCGGAGCACCTATCTGCTCTGGCTCTTTGAGGCCCCTCCC
TTCCCGTTCATTCTTCTGCCAGTGGCAGAAGTGCACCCACGTGTGTGCCTTGCTTCTGCC
CTGGAAAGCTGGGCCTCAGCCTAGACATCAGGTGACTAGCTGTTACCTAGCTAGTCCCCA
GATTCCACCTTAATTAAGCAGCCTTACCTGTTTTGATCTTCCATTTCCTGACTTGGAAAA
CTAAAGCTAAGACAAAGGTTTTTCAGGACTGACTCCCCCTTCTTCTTGGCAGATTGTGGG
GCTCTGTGCAGTTGATGTTAGTTAACCACTGGATCCACGTGTTCACCGTGGCTTGCGCCC
CTGCATCCGAAAGTGATCTTGGCTGCCGTGTCCTGGTCATTGGTAGTGCAGGGAAAGGAT
GCGGAAAGACGGGCTCCGAGCTCGGGGCGTCTGGCCTGGAGCTTTCCTACACTTGTGTCT
TGCTCTGCAGCCTTACGGAAGTGTGGGTGGCGCTTTCTGGAAGCTGCACAAGTCAGTGCT
GGGTCTTCGCAACTTGGTGTTCTGTTTCCAGAAACTTGGGGTGTTTGCATGTGCTAGGTC
AGCACAGATTTCCAAAGGATCTCTAGGTGGGTTCCCTAACTTTTCACAGAGGAGCAGAAG
GTAGATGACAGGAGGAGAGGTGGGGCTGGACTGAGGGGAGCTGTGTGTGCCAGGGTGGGG
TGGGGCGGGGCGTGTAACAGCCCTTAAGCGTGTGTTGAGAGAAGGAGCTCCCTGGTACAG
AGTGTGCAGCTCCCTTCCCAGCCTGTGGTCCCCGTGGCCCAATGAGTTTTTGTATCACTT
GTGAGCCACTGGTCTTAAAATGCATGGTTTGCAGACCAAAATGCAGTCCAACATTATTTG
TTTCATGTGTCTATGTGAATGCACATATGTATGTATGTCATTTGTGCCTGGTGCCTGTGA
AGAGTTTATTGGGGGCTAGGAATTTCAGAGGGTGACTCTTCAGGATCTATATGGCTTCAG
GCACGGCCATGTTGGACAGTAGCTGGGAGCTCACATACGTGATAGGACCACCAGGCAGGG
AGCTAACTGAATGGCATGGGCTTTTGGAGCCTCAAAGCTCTCCTGCCCCACCCCCATGAT
ACCTCCACTAACAAGGCCATACTTCCTAATGGTCCCAAGCAGTTCTACCAACTAGGGACC
AAATATTCAAGTATATGAGCCTATAGGTGGAGGAACTTCCACACAGATCCAAACTTTTAA
CAAAACAAAAAGCAGGAAAGCCAACTTTATCAGAAGTTACAATGTAATCAGTGTCAGAAG
GAAGAGAATGGAAGTGGGAGACTGAGGTGGGGGGTATGCTGAGGATATGGGAAGTGGGAG
ATTGCGTGGGGGGGGGCTGAGGGTGTGGCTTTCAGTTGAGTGTCCAGCATGGGAGGAGAA
AGGGGGCTCTGGGAAGAAGCTGCTGCAGCCACCTTGTGTTCCCCCCACCCCCAGCTAATA
GCTGTGTCTTGGTTCCTGGTGAGATCTTGGTTGACTCGGGGGTCCTGAGTGTGGCTTGTC
TCTGCAGGATTGTCACGTGTGCTCAACAGTCCTCCTCGGCTTTCCAGAAGAGGCTGGAAC
AGGGCCCTTGAAGGTATGACTCCAGATGCCTCACTAGAGAGCTGCAGAGGTCCAGCAAAG
GCCCACAGTCATGAAGAAAAGCTGAGGCTGCTTCCCCACCCGGGCCAGCGGGAACATGGC
TCCTCCAGCCCCTGACACCTCACTTCCCCACATCTTCATAGTGTGAAGTAAAGAGCTACA
CTAGGGTCACAGGAGCCCCTGGGAACCTGCATGGCTTCATTGGGTTCTGCAGTTGGCTTG
AGAATGGCTACAATTGGGGTGCAGTTAGCCTTCTCTGAACTTCTCTGAACTCTGGGCACT
TGTTAGGGAGCAGTCCCGTCCCAGACTCATGAGGACTCGTGAGTCCTCAGAAGTTAACCC
CCCCCCCAACTTGTCTTTTTTCATTCATTGTCTTAGTAAGAGGCCACTGAAGTAATGGTT
CTCAAATTGTGGTCTCTGAAGCAACACTACCACCATCCCTTGGAGTGTGTGAGAGTGGTC
CTGCCTGCAGGCAGCAGTATTTAGCAGCTCTCCAGGGGATTCATGGTTGAGAAGATTGGA
GAGTTGGGAAGCTACCTCTGTTACAGGCTGTAAATATGGTCACTGTTTCCTGGTCACTTG
TCCCAGTTTGGCCCTTTCCTAAGCTGCCCATCCATCCATTGTAGCTTCCCTCCTGCCCCT
GTATTCGAAAGTGATTGTGGGCTGCCGGTGCCCTGGTCATTGATACTGCAGGGAGAGGAT
GCCGAAAGCCTTTCCCCGTGTTTGGAGGATCACACTTGTCCTTGCCAAACCCTGGTGCTT
TCGAACAATCTTCCTTCTCCCAGCCTAGTGGTCTCTCAGTTGCAGATACCAGGCTCATTT
AGAGTCCTCTGCCAGTGCCGGGCAGTGTCCTAAGAGGACATTATTCTGGCTCAGTTTTGC
AAATATCCCATGAGCCCCAGTCACATCCTCCTTCCATGGCTGTGGATTCGAGGCCTGCAG
ACAGACATCTGTCTGGTAGATGGGTGGCATGTTCCCACATGCAGTGTCAGGAGGAGAGTA
AACTTGGCTAACAGGGATGCTGGTCCCTGAGCCTGTCTAGCTCTGACCTGTTGTTACCAG
CTTCCAGTTAGCTAACAGTGCCCGAAGCTACGTGATGATATGGTGGAGATAAGAAAGCAT
CATGATCCCCCTCCCCTTTAATTTTCTAGATGTTTGTGGACATCAGAGGGCCAAAGACGA
CACAAAGTGAAACTGGAGACACCGCCCCCCCTTGGCATCATGAAACTGCCGATGTTACTG
GCTCATGCATGGGAGACACCAGCATACAAAGTCTTGACACCAACACCTCAGAGGGCTGTG
TTCTGTCCCCGTGACCATCATCTAGTGCCTGGAAAGACTAGTGACAAGAACTTGTTGCCA
ACTTCCTATTACCTCCCTAACAGTTGTGCAATAAACCCCATAGGTTAATTCAGTCTGCCT
TTTAAATCTGTGTCAACCCATGAATTCAGGGCTAGGTGTGGAAAAGGAGGCTAGCTCCTG
ACACGCCTGTGACTTTCCTGTTCTTAATGCCCCCTGAGGCTTGGGCTTCAGGGTGTTGGG
AGTGGACAAGTAGGGCTGGTAGTCTATATGATTTTAGGGCTTGTGAGAGTTGAGATAGCT
GAACAGAGAAGGTCAGAACTTGGGGAAGGTGCCTGTGTCAATAAAAAAAGGCTGGGGTGT
CACAGTCCTAGGAAGTGACGTATCATTGCTGAGAACTAGGGGTGTGAATGGGCAAATGGA
CTGGAATATAAAATGTAGAGCATTTTCCTGACAGGACAGGTTGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved