Mus_musculus Locus Mono:143:SNORA70
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:143:SNORA70
Mus_musculus
Mono:143:SNORA70
8
SNORA70
1001..1134
2134
CTCAGACTCGGAAACCCTGCAGCTCCTACCGTGCTAGGGTTTCAAAGAGCCGGGTGGGA
AGAAGCCTAGGGCTCACTCATAAAGCAGAAGCTACGGCCAAAAAGCTGTAGGGCAGGCGG
GGCAGCTTTCCCAGCCTTGTCCTGCCTTCCGTCCTCTGTGGGGTGGACATTAAATACATC
TACATAGAAGTCGACAAAAGACTTCTTCATTCTGTGACCTGCAAACACGCATGCTTTGGT
CTGAAGCCTTGAATCTCTCCTTCTTTCCAGTAGCTTACTAAGCTTGTGGAATTTGCTTAA
TAATCCTACGGAGCGACTTTCTTCCCAGAAAATCTAAACATGAGCCCCATCTGCCCTCCT
TCAGAGGGCGACCCTTCTTTCTTCCTCCCTGTGCCCATGCCCCGACTTGTCTGGAGCATG
TGATTAGCAGGAGACCGGAGCAAAAGCTCCTTGCAGGGGCTCTGACTGTCTTTCAAAGAC
TTGACAAGAGCATTTGAAAGAAGCTCTTTCAGGACTAGCCTTGCTCCATCACAAAGACCT
ATGCGTGGAACTCACCTCGCTCTGAGGGTCAAAGGCAGTAAGTCAGCAAGCACAACGCGA
ATTAATAAGGTGCCAGGTGAAGGCATAGCACTGTCCGCAGTAACAGCGTGTATGTAATTT
ATGAATCAGAGTTAGGAAGGAGCACTATCGATACACACAACTGTCAGGCATGGAAGCACA
TGCCTGTTAAGTCCAGCTCTTAGGGGATAGAGGCAGAAGGGTTAAAGTTCAAAGCCACCC
CTAGCTACATAGAGAGATTGGGCTACATGAGACCATGTCAAAAGTGGGAAGGAAGGAAGG
AAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGGAGA
AATCAAAAAGAAAAACAAAGAGGAAGGAAGGAAGAGGACTGACTGACTGAATGAATGAAT
GAGCAAATAAACAAATAGCACAGTTAGAGACAAGAGTGACTATGTAGTCAATTAAGCCAA
ACAGGTCCTTCCCTCATGGGGGCCTGGTACACAATGGCTATGGGCAGCCATCTTCTTGGT
AGTGTATGAAGCCTGTTGCTTAATAAGAGCTGCACTAAGGACCTTGGAAACAGATTTCTG
GTAGAAACTCATATCTCTGTATATTTCCTGCTCTTCCCAGTCTAGGCTCCAGACAGGTGT
TCTGGTGCCCTTGGGAAGGCCTGGAACATGGTGGTTGTGTTTCACACAGGCCAGGTCACC
GTGTTCATCAGTACCAGGCTGCAGACATGTACACACATGACTGTTGTGGCCTGTCATAAA
GGCACATGCAGGGCTCAGTGGTTAAGAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCA
AATCCCAGCAACCACATGGTGGCTCACGACCATCTCTAAGGAGATCTGATGCCCTCTTCT
GGTGTGTCTGAAGACAACTAGAGTGTACTTACATATAATAATAAATAAATCTTTTTTTTT
TTTTTTAAAGTCAAGTGCAAGTTCTCTGGCACCAGGAAATCCACATCGCAAAGAAGTAGG
GCTGCAACAAGTTTAATACAGATGAGTTAGAAGACTGGAAGCTGGGAATCGGTGAGTCCC
TGATGGCCGTGGGTCACACACATCCCCAGCTGTGGTCCACTGGAAAGTGGTGAGCCCCGA
GCTCCTGAGGACTTTCATTATGCTGCGTCCTACATTACACCATGATCAAAATAAATCTTA
CATCCAATCTAGGGGGAAAAAAAGACAAAATGGGCAAACGCAATGAACAGTTCAAATCTG
TTCTTCCACCTGAAGAGAGGGGTCAGTTTGAGTGTTAGGGAGACTTTATGCAGAATGAAT
AAGTAGCAGTTAAAGTCAAGGGCTTTGACTGCCACCATGCCTATGTCCAGAGCCTGGCTC
CTCCATCTCCTGGGACGGACCTAGGACAAATACATAATCTGTTTCTGCCTTAGTTTCCTC
ATCTGTAAAATGGGGGTATTCCAAGTATATCTCTCACAAGGCTGCTATGAGGAATGCACA
GTTGTTCATTTCTTTATTTGTTATTGTTTGGCTCCTCGCTGCTGGCATATGACTACTATG
ACAATGGGACGCGTTCTTTGCTGTTCCGGTGACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved