Mus_musculus Locus Mono:125:SNORA57
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:125:SNORA57
Mus_musculus
Mono:125:SNORA57
19
SNORA57
1001..1148
2148
CTGGTCTACAGGGTGAGTTCCAGGACAGCCAGGGCGACACAAAGAAACCCTGTCTTGAA
AAAAAAAAAAAAAAAAAAATCCAGTGAGCAGCTGGGGGGTGGTGGGGGTGGTGAAGGACT
TTAATCCCAGAACTTGGGAGGCAGAGGTAAGTGGATCTCTTAGTTAGAGGCCAGCCTGGT
CAACACAGAAAGTTCCAGAACAGCCAGAGCTACAGAGAAACCCTGCTTGAAAACCCGAGA
CAAAACAATCAACAACAGCATCAGAATCCTGTGAGCAATGATACCATAAGAGGCTAGTAG
TTTGGAAACTAACATAACTCTCAACTAGTTGCTGCATAAACGTGAAAGAGAACAAGAAAT
TTGGAGACCTCTGGGATGCTCTGAAACCTGGTAGGAAGTGGGTAGGAATGTCCAACCGGA
GGATAATACTGTACGTACGCCCGCTTCTTGAGGTGGTGCTTCGTAGTCAGCCCTTCGTCT
ATCACAGCCCCGACCACCTGGCGTTTCCGTCGCCGATCCCTGCTTAATACCCTGCGGCGC
TTGAACAACTTCTTCTTCAGCTCCTGCGGAAGAAAAAGATGCGCATGTAAGGTTCTGCAC
ACCCACCCGGGATCCTCCGCACCTAACAACCCCAGCCCCTAACTAATCCTGTTTCCAAAG
AGGAAAATGCCGGGAAGCAAAGGGAAACAAAGACGCAGTTCCCACTCCCACAGTTCAGTC
ACCGTCCGGGGACGATTGATCTTTCCTCCCGGAGGTGCCATGGCTACACTCCGCGGCTCA
TTCCAAAAGCCGCACTTCCGCTCCGCTCACAGGTTCCGCCACACGCAAAAGACCCCGCCC
TCTGATGCCTCCGAACCAATCGCAGCTTGGAGGCGGGCACCAGGGGTATATAAGGTTGTT
CCGCGCGTTGCGGGGCCTTTCCAAGGGTGGTTTTCACGTGAGTCTTGATTTTGTCTTTAT
ATGCGAGGGAACTACTGGGAACTGGGCCTGACTTTGTAGATCCTCCTTTTCTTGGCGGGG
ACCGGGCGTGCGGTCCCGCTCCCCGTAATGTACGGAGGTAGAAGAAAGGGCTCTGGCCCT
CTCGGCGTTATGTCTTCGGTGCTTGCGGCTTCCCGTTCGCGGGTTCTATCCTCAGACGCC
GGAACACTTAACCGTGCAGAAATGTAGCTAGGTCCCGCAGTCCCCTCTGGGTTACTCAAC
GCTTTTTATTTTATTTTAGGTCGACATTGACGCTCCCGGAGTGATGGTTAACATTTTCTT
TGCTGTTTATTATTGAATCAATAAAGTCTGTGAACCCTAAGGACCCTGTGTTCGCTACCT
TTTTTTTCTGCGACTCGTAATTTGCAAATCTTTAGGACCGAAAGCACATGTTGGGAGTGA
TAGTGACTATTCACTAAAGATCTCTGGTCGATCTTGTGGGGGGACTTAATAAGCTAAATC
TCAACCAGGATGTAAATCTTTATGAGTATAGAAAGTGCGCTCCTAAAGGCATGGGAATCA
AACCTGTAGTTATGGTAAAAAGCCTAGCGTAATGGTGCGCACGTGTAATCAGCAGAACTA
ACCTGGGGTAGCATGCACCCTTATCTTCAAGCTTCCTGGCATTTAAACTGGCGGTAGGCA
CAGCTTTCTCACTAAGATATTGGAAGTAAAACTAGGATCTCAATCCTCCACAGGCATGCC
CTGTGGATGTTCTCGGGGTGGACTTGTCTCCGTGCTGGGACCTACATAAACAGCCTTATA
CAAGGAGGCCATTGCCATTCCCAGTGCAGAATCTGGGAGCCCTAGCATCCTTAGGTTCCT
CACAGCTCTCCAGGGATAATTGTTGCTAAGCGAGATTTGCCTGAGGATTCAAGGACCCTC
CTTTTCAGCTGCCCTACTAGAAGTAAGAAAAAAAAAATCCAATGGCTGGACTGGGTATAA
AAATTAAGCCCTAAACCGGGCAATGGTGGCCCACACATTTAATCCCAGCACTTGGCAGGC
AGTGACAGGCAGATTTCTGAGTTCAAGGCCGGCCTGGTCTACAGCGTGAGTTCCAGGACA
GCCAGGGTGATACAGAGAAACCTTGTCTCGAAAGACCAAAGAATAAAAGTTAAGGCCTTA
TAAGACATTCAGTTAAATCTCAAAAGATTTCTGAGAGTTTCCATTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved