Mus_musculus Locus Mono:432:SNORA67
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:432:SNORA67
Mus_musculus
Mono:432:SNORA67
11
SNORA67
1001..1141
2141
TTAGGGCAATCAAATTCAGTACAAGGAAATAATTAAAACTTCCAAGAGTCATATTCAAA
ATCAAACATGTAGTTATGTTGAATATAAGACATAATAAAAATATATAAGACATAATAAAA
AGGACAAATGGTGAAATGCAAAGGGCCAGAGTCCCACAAGAATCTAACTTAAAGCAAATC
CCTTGGAATGATTTAAGCTGCAAACTTCAGTCTCTGGAACCATAAGATGGATCCTCTTTA
ATGATATTCAGAAGGGGAAAAGACAGTTTCTGCAACATCTTAAGAGATGTGAAAGCCAGG
CATTGGTGGCACATGTCTTTAATCCCAGCACTTGGGAGACAGAGGCAGGAAGATTTCTGA
GTTTGAGGCCAGCCTGGTCTATAGAGTGAGCCAGGGCTATACAGAAAAACCCTGTCTCAA
AAAACAAACAAACAAACAAAACCAACAACAAAAAAACCAAGCCAAACCAAAAGAGACGTG
AGAATGAAAGTATTGGAAACAAAACTATAAGAGGGGCCAGTGAACAGCGCTGCCACATTG
ACGTCTGTAACCCCAGGCTGGTAAGAAGAACTTAAGTAATTCGTTCTGACAGAGGTGTAG
CTGCTTCATTAAAAATGTGTATTTTAAAGATATATAACAAATACGATTTACTTTATAAAG
AATACAAGTGTTTGAGAGCACACATGAGCATATGGGAGCATGTGGGTGGTTGGATTGCTT
AATGTGTGTCAGATCCTTTATCGGCATTGCCATCCTTCTATTTATATAATGTAGTTTTTT
GAGAGCACACATTTGCTAAGTGGGGATGGGAGAATTCAGACTCAACTTTGAAAAGCTCGC
ATTGGGCTTACTTCATTAGTAAGATTTTAGCCACCAGTTAAATTGTTCCGTCTAAGCTTT
GAGGATACTTAACTGACAAAATTAGAGATATACAGTAGCGTTCTAAGGCTAGGAATACTT
CAGCATGCCATTTCTCTTATTTTCCCACTCTACTGCTCCCAGTCCAAGGTGATTCCCTCT
CCAAAGGGCTGACTGTGTGCCACTTTCAGGAACAGCAATTTGGAAGAAAGCCAGGCATGC
CTGAGGTCTTTGATGAACAAGGAATACTTGTTTCCTTTGCCCTCCTCTGGCTGCCTACAT
GTATATCTACTTAGTCAGGATAGGTAGCATCCTCTGATGGCATATTATCTTTCTTGACCT
AGGCCAGAGGCATGGATGTGCAGCAGGCTTCCTTAGTCATCCATTATGACCTTTCCCATC
AGCAGGGAAAACTACATCCTCAGAATCTGTCTAGGTGGACGGTTTGGCCTTAAGGGTGTG
GCTATCAACTCGGTGACAGGACAAGAGGACTCTTCAAGACATTGACTTTCTACAACATTT
CCATGTTGCTGACCTCATTTGAGGGTCTGTCCTGCTACATGGACCTAGTGCAGGGTTTAG
TCCTGGGGGGCTAAGGAACAGCTGGAGTGGGGAGGGAAGGCAGCCAAGGGATAGACATCT
TCCCTTTTGAGGCAAAAAAGAAAAAAGACCCCCCCCCAAAAAAAACCAAACAAACAAGGA
GATTGAGAGGACTACCGAGCTCCTGGGCTTTTGCAGGGGCTGTGTTCATTTGCTCCACCC
TGCTTATCAATCTGGTCTAAGAGGGTAGAATGGGCTCATTTCCTAGTGAAGGACAAGTTC
ATTACAACTCTTCTACTCCAACTGATTTCTTACAGGTTTATCCCTCTTCCTGCCTCCTTG
ATGCGGGTGATCTAGCACAGGGCCAAACAAAAAAAATATTACAAAAGTTAGGAAATACCT
AATAATAAAAAAAAGTATAGTTTAACAAGCAAAAAAAAAAAAAAAAAAGAGTTAGGAGAT
GACCTGTAATGGACCAAATATGTCGTTCCAAGATTCAAGGGTTGAAACTTTATCACCAGG
ATGATGGAATTAAGTGGGATCGCTCGCTTTAGTCATAGAATGCAAGGTCTATTGAAATGA
ACAACAGAGGGAGGGTGTGGTGGGTCTGAATGAAAATGGCTCCCATAGACTCATATGGAA
GAGTACTATTAGGAAGTATATGCTTGGAATAGGTGTGGCCTTGTTGGGAAGAGTTGTAGC
ACTTAGGGAGCAAGCTTTGAGACTTTAGACGCTCAAGCCAGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved