Mus_musculus Locus Mono:113:SNORA68
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:113:SNORA68
Mus_musculus
Mono:113:SNORA68
1
SNORA68
1001..1136
2136
CTTCTCAGCCATTTGAGATTTCTCTGTTGTGAATTCTTGATTTACTTCTATACCCCATT
TTTTTGATTGGGTTGTTTGGTTTTATTTTGGCGATTAGCTTCTTGAGTTCTTTATATATT
TTGGATATTAGCCCTCTATTGGATGTGGGGTTAGTGAAGATTTTTCCCCCCAATTTGTAG
GATGCTTATTTGTGTAATTGAATATGTCCTTTACCTTCCAGAATCTTTTCTGTTTCATGA
GGTCCAATTTATCAGTTCTTAATCTTAGAATATGAGATATAAGAGTTCTGTTTAGGAAAT
TTCTCCCTGTGCCAATGAGTTCAAAGCTCTTCCCCAGTTTCTCTTCTATTAGATTCAGTG
TATCTGTTTTTATGTTCTTGATTCACTTGGACCCAAGCTTTGTGCAAGGTGACAAATATT
GATCTATTTTTATTTTTCAACCTACAGACAGCCAGTTAAAGCAGCACCATTTATTGTAGG
TGTTTTCTTTCTCATGTAATTTAATGATTACAGCAGAAACAAGTATCAATTCCATAAGCT
TAATAGTCTGAATGTTCTTATGAAGGTTAACTGATATGATGGGTCCTTCATAACTACAGT
CCTGATCATCTGTCCTTCAGCAAATATCCATTTAAAATCAAGGTTTTTCAGTCTGTAGAC
CTGATGAATGATCTTTCCTTTTTTTATCCAGATATTTTGAGATGTCCTCATGCAGGTGGG
GATCAGTTTTATGTGTCATTTGCATTTCTTGTCTTTCTTCATTTGTTTGTTCCTTGAGTT
TTGCCTTTTATGGGCAAGTTTTTCTTATTTTCCTATTTTCTTTTTGAGATTGCAACTCTA
TCAGATTTGTTGGAAAGCATAGCCTTTGATCACCTATACAAATATAGTAAATAGTATATT
CTCAACATAACACATTGCCTTATTTCAATTCTGATGTTAATCTGTAAAATATACAGTTTG
ATCTAATTCACCAGGTTTTTGTTTGTTTTTAAAATTGGTGTCTGGCACCCATCCCAAGAA
CTGGTGCTGCCTGTAGTTGCTGTCTTAACAGTGGTGCACACAGCAAAGGGGCTTTGTTGC
TTTTGGGGGGGGGGCTGTGTAGTGCCCCCCCAGAGTGAATCAGTAGGTTCTACAGTCCTG
GAAAAAAATAAAATTGGTGTCTTTAAACTAATTTTATTTCTCAATTCCTTTTATCAAAGT
ACAATTAGATATTAATTAATCAATGCATAAAGGAGACAGTTAGGCATTCACATTTCATGC
CCCTCTACATAGAGACTGGCTTCTTACTAATTGTCAATGGCTGTCTATCTTGATCTTCAA
TTTTACTAGATACCATAGGTTGATAATTAAGTATTTTCTGTTATTTTACTTTCTCTATGT
CTTTTCTCTTAAGCATTTGTGGTATCACAGCTAATATTTCCTCTAATATAGCTATTTTTT
AAACCTTTTCTGAAAAGAAAACTATAAAGATTAAAAATGCATGTAAGGAGGAGTTTACTC
TAGTGCTCAAAATTATGGCGTTTTCCAGGCATATTCCTACACCATCGACCCGTATTCTTG
GCTTTAAGAGATCTATAATTTAGTTTCCATTTCTATTACGGGAAATGTCTATGAATATAA
TTTAAATTTTACTTTGGGGTGGCTCAATGTGATTTGCTGTCTCAGAGCCTCCTGTGCCAT
TCCGTGCTTTGGGCTCGACTGTCCTATGGTTCCAGAGGCTCCTGAGTATCTCTTAATGTC
CAGAAAAAAACAAAGATCTGATGCTTCCTCTGAAGATGATCTAATATAAATTTCTACTCT
GCAGCTTTTTGTCAGATAGCTCAGATATTCTGAGATTTTTTGTTCTCAGACGTCCTTTGC
TTTCTGAAATGTTAGTGGGCTTTCTTCTTCTAAATGCAGACATCCAGTTAGACCAGCACG
ATTGTTTGAAGATGCTTTCCACTGTATAGCTTTGGCTTCTTTTATCCAAAATCAAATGTC
CATAGGTGTATGGATTTGCTTCTAGTTCTTAAATGTGATTACATTGATCTATAAGTCTGT
ATATGTCAGGAACATATAGCTTTTATTACTATTGCTCTGTAGTAATATTGAAATTAGGGA
TGATGATATCTTCAGTAGTGCTTTCATTGTACAGCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved