Mus_musculus Locus Mono:204:SNORD12
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:204:SNORD12
Mus_musculus
Mono:204:SNORD12
X
SNORD12
1001..1083
2083
TGTTCACCAAAATACCACAAAAAACAGTCTTTATGCCACATACTGAAATTCTTCTCCTT
TGAAATCTCTTGGGCCAGGTCAACACAGTTCAAATTACTCCCAGCAACAAAGTCTTCCAT
ATTTCTACTAGGATGACCCATTAAGCCCCATTTAAAACATTCCACTGAGTTCCAAATCCA
AAGTCCAAAAATCCACATTCTTTCAAATAAAAGCATGGTCAGGCCTATCACAGCAACACG
CCACTCCTAGTACCAGCTTCTATCTTAGTTAGGGTTTTACTGCTGTGAACAGAAACCATG
ACCAAGGCAAGTCTTACAAAAAACAACATTTAATTGGAGCTGGCTTACAGGTTCAGAGGT
TCAGTTCATTATCATCAAGGTGGAGCATGGCAGTATCCAGGCAGGCATGGCGCAGGAGGA
GCTGAGAGTTCGATGTCTTCATCAAAAGGCTACTAGTGGAAGACTGACTTCCAGGCAACT
AGGGTGAGGATCTTGTACCCACACCCACAGTGACACACCCATTCCAACCAGGTCACACCT
ATTCCAACAAGGCCACACCTTCAGATGGTGCCACTCCCTGGTCCAAGGATATACAAACCA
TCACAAAGCTTATGCATCAATAAGGGCAGAAGCTCAAGACTAATATCCATTACACAGGAA
GTTTAAGACTAGCCTGGAATATATAGATCTTGTCTCAAAAAAATCTATGAAAAACTAAAT
TAATTAAGAGACCAATGACATGGCCCACTGAGTAGTGGTGCCTGCTGCCAAGCCTCAAGA
CCTAATTTGATTCCTGGTACTCTTACATTCTGCTTACATGGTGTAGGAGGAAACTGACTC
TTGGAAGTTGATCCTCTAACATTTATACACATGCATGGCACATGCACATCCATACAGATA
TACACATACACATACAAAGCAAATAAAAATGTAACATTTTTAATTAAAAGAAAAGAAAAG
CAGCTAGTGCATAATTGCATGTAAATGAAATTTGAAAGTATGTACACATGTGTGATGACA
CAACTTTTTTCCCCATCAGATCAACCATGTTGATCACATTCTTTTAAGCCAGTATCTTGT
TTATAATAGCCAGAAGCTGGAAAGAACCCAGTTGCCCCTCAACAGAGGAATGAATACAGA
AAATGTGGTACATTTACACAATGGAGTACTACTCAGCTATTTAAAAAAATGAATTTATGA
AATTCCTAGGCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGAGGTAACCTAATCAC
AAAGGAACTCACACAATATGTACTCACTGATAAGTGGATATTAGCCCAGAAACTTAGGAT
ACACAAGATATAAGATACAACTTGCCAAACGCATGAAATTCAAGAAGAACGAAGACCAAA
GTGTGGACACTTTACCCTTTCTTAGAAATGGGAACAAAACACCCATAGAAGGAGTTACAG
AGACAAAATTTGGAGCTGTGACGGAAGGATGGACCATCTAGTGATTGCCATATGCAGGGA
TCCATCCCATAATCAGCTTCCAAATGCTGACACCATTGCATACACTAGCAAGATTTTGCT
GAAAGGACCCAGTTATAGCTCTCTCTTGTGAGACTATGCCGGGGCCTAGCAAACACAGAA
GTGGATGATCACAGTCAGCTATTGGATGGATCACACGGCCCCTAATGGAGGAGCTAGAGA
AATTACCCAAGGAGCTAAAGGGAACTGCAACCCTATAGGTGGAACAACAATATGAACTAT
CCAGTACCCTGGAGCTCTTGTCTTTAGCTGCATATGTATCAAAAGATGGCCTAGTCGGCC
ATCACTGGAAACAGAGGCCCATTGGACTTGCAAACTTTATATGCCCCAGTACAGGGGAAC
CCCAGGGCCAAAAAGGGGGAGTGGGTGGGTAGGGGATTGGGGGGTGGGTAAGGGGGACCT
TTGGTATAGCATTGAAAATGTAAACGTAGAAAATACCTAATAAAAAGAAAGAAAGAAAGA
AAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAGGAAAGAAAGAAAGAAAGAAAGT
AAGACAGCTCTACTGTGTTAGGAGGAAAAGAATAGACAAATAGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved