Mus_musculus Locus Mono:333:SNORA4
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:333:SNORA4
Mus_musculus
Mono:333:SNORA4
9
SNORA4
1001..1152
2152
TTGGGTGAAACCCAGAGACATTCAGCCAGATTGATTCAGGTTAAGTCTTGCGCGTGCTC
GACTGGCCAGGAAGAACGACGCTGCAACAGGATCCTTCTGCACACGTTTATTGGGAGAGC
TTGATTGTAGAGGCGAAAAGACCCCGAGCCCAGAACTGGTGCTGCTTTTATAGGCCTAGG
AGAGGCGTGTCTCACACCCGGATTGGTTATGCACTAAGCCTCATTTGCATGTTCCTCATC
TGATTGGCTACTCTCTCTCAGTACCTTACAGAGCCTCATTATCATACCTCATTTGCATGT
CTCACATCTGATTGGTTATACTCTCAGTACCTTACAGAACCTCATTATCATACCTCATTT
GCATGTCTCACATCTGATTGGTTATACTCTCAGTACCTTACAGAACCTCATTATCATGCC
CGGGCCAGGCAGTGTCTTTGCAAAAAACTTTACTGCATATGTACACATTGGTTGTTTGTC
CAAACTTATGCGTGGTGGCCAGCAGTAGTCAGTGCCACTCAGCAACGGCACATGTGGCTT
CCCACAGTTAAGAGTCTAGAGCAGGGCAGCAAGTGGAATGTAAAGTGAATAAGTAAAAAA
TAAAATAAATAAATAAATAAAATAAAAGTAAAAAAAGAATGCCTAGGGCAGTAGTTCTCA
ACCTGCCCAATGCTGTGGCCCTTTACTACAGTTTTTCATGCTGTGGTGACTCCCAACCAT
AAAATTATTTTCATTGCTACTTTGTAACTGCAATTTCGCTACTGTTATGAATCATAATGT
AAATATCTCTGACTTTTGCTGGCCTTAGGTAACCAACCCCATTAAATCAGCCCCCATGGG
TTGTGACTCATACGTTGAGATCTGCTTGTCTAGGTGAACAATCTGGGAGCTGTTCTTTCA
AGAAAGAGTTGACTGTCAATCTCTGGGGAAACACGACATCTGCTGTGGCCAGGACTCTGA
AGCAGCTCAACCCCAGCACTAATCACTCAGATGTTTCAGAATGACCAGTTTCTGTCCATC
CTGCTCATAAGAAGTGCTCCAGAATATTAAAAAGCCTTAACCAATTCATGCTATTTGGCA
GAATGAGTAAGACCACACTCCACTGTGGGCTATACTACTTAGTATGGTTCATTACTATAT
TGTGGCCTACATTGATAAAATGATAATAATAATAATAATAATAATAATAATAATAATAAT
AATAATATCATCGATTTAATTAAAAAATCAAAAAGAGAAATTAAAATATAAAAGATTAAA
AAAAAGAAGTGCCCCAGAAGTTTTCCACTTCATTCCCCCAGTAATGAAACATAGCTAAGC
CTAGCTTCAGGAGGGAGCCAGCGAACCCCTGCCATCTTGAAAGGCTCCCAAAGGCTAGGG
CATGTTCCTTCTTTCTTCCTCTCCAACACTGATTTCCCCCTCTCTTTGTACAAGTTTGCA
AGGCCACCCCACCCCAGCCTTCTTTGTCTTGCTATACGTCACTAGAATCTCACTGGGAAT
TAGAGTGCCTATAGGTCTCATTGCTCACCGACTACCAGTTCTTCAACCACCACTTGGAGT
CTTAAAGTTCATTTTCTTTGTTGGTTGGTCTTTGCTTTAAATAGTTTGTTGTTTTTGTTA
AAATTTCCAGATGCTCTTGGCAGCGATAATGTTACAGGTGGAGTTATTTGTCTGCTATGC
TGCTGATGGAGACAGTCAACATGTCTTCAGACTTGCTAGAATTCTTTGACAAGACGGTAA
CCTGAGCTTGGATTCAGGTTATAATCATTCTGGAACTGTCCACAAAGCCTTATAGTTTGT
TTTTCTTCAGTGGTGTTGTGGTGTCAATGCTTGTGCCCTCCTCAAATTTTTGAAGTGACA
ATCTCAGGTACAGGGCTTAGAGGGTGATCTTTTTTTTTGGGGGGGGGGAGGTGATGGATG
ATAAGGAATGGAGCTCAGGGCTGGGGTAAGTGGTTGATCTCACAAAATCAAGGCAGTTGC
TGTACTCCTCTGCCAGGCAGACACCGAGAAGAAGCACCACCCATGAGAATCAGTTGATAT
CACAGACTCCATGAGAGCCCCAGTACAAACTTCCCTAATTCTAGAGAAACAAAGATTTGC
TGTTTATAAACCTCTGGGTCTATGGTACTGTCTCTAGACATATCAAAAGGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved