Mus_musculus Locus Mono:179:SNORA19
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:179:SNORA19
Mus_musculus
Mono:179:SNORA19
14
SNORA19
1001..1130
2130
GCAGGTCAGGAAGCAGGAGCTGATGCAGGGGCTATGAAGGGATGTTACTTACTGGTTTG
CTTCCTCTAGCTTGCTCAGCCTGCTCTCTTATAGAACCCAAGACTACCAGCCCAGGGATG
GCACCACCCACAAGGGGCCTTACAGCTGGATCTCATGGAGGCATTTCCTCAAGGAAGGCT
CCTTTCTCTGAGAAAACTCCAGCTTTTGTCAAGTTGACACACAAAACCAGCCAGTACACC
ATCTAAGTGCAAAAGGATGGAAAAATATATTACAAGAAAATGGACCTAAGAAGCAAGCTG
ATATAGCCACTTTAATAGTTGACAAAATAGACTCCAAATCAAAACTAATCAGTATATATA
GTGGTATAGAAGGATATACTCATCAAAGCAAAAGTCCACCAAGATGATATTGCAATTCCT
AGTATCTATGGACCAAACACAAGGGCACTTGAGTTCATGAAAGAAACATTCCTACAGCTT
AAATCATATATTGAACCTCACGCACTGATAATGAGTGACTTTGATACCCCAATTCTCACC
AGTAAACAGGTCATCCAGACAAAAACTGCATTCCAGAGAAATGTTGGAGCTAATTGCCCT
CATAAACCAAATGTACCTAACAGATATTTACAGAACATTTCACCCAAACACAAAAGAGTA
TACCTTCTTCTCAGCATCTCTTGGAACTTTCTCCAAAATTGACAGCATACTTGAACATAA
AGCAAGTCTCAATAGCTACAAGAAAATTGAAATAACACCCTGCATCCTATTTATATAACC
ATCATGGATTAAAGCTGGATATCAACAACAATAGGAAGCTTACAAACTCATGGAAACTAA
ACAACTCAGTGCTGAAGGAAAGATGAGTCAAGACAGAAATTAAGAAATTAGAGGCTGGAG
GGATTGCTCAGTGGTTAAGCGCACCAGTTGCTTTTCCAGAAGTCCTAAGTTCAATTCCCA
ACCACCACATTGTGGTTTACAACCATCTATAATGAGTTCTGTTGCACATTTCATCAACCT
GCTTTCTTTTGAATATGTGAGCAGTGTTGTTTCTTACGTGCTATACAAATAGTTGAAAGT
AATTAGTGAGTAACTGCCTATAGTAATTCTGTCAGTGTCCTTCAGACACACACACATATA
TAATGAGTTCTGATGCACTCTTCTAGTATGCAGGTGTAAATGCAGATAGAGCACTCATAT
ACACGCATGCATAAAATAAGTAAATCTTTTAAAAAGTATTCTTTTTTTTGAAAAAAGTAG
AAAGAAATTAAGGATTTTATATAGTAATGAAAATGAAAACACAACATTCTTGAGCTCATG
GGACATGATGAGAGCAAGTGCATAGCATTAAGTGCCTACATAAAAAATTGGACAGATACC
ATATTAGTAACAGCAGCACACCTGAAAGTTCTAGGACAAAATGGAGAAACAGCACCCAGC
AGGTTAGATGTCAAGAAACAAACAAACTCAGGGGTGGAATCAACCAAATAGAAACAACGA
GCATAAATATACACAGAATCAATGAAATGGAGAGTTAGTTCTTTGAAAGAATCAGTAAGA
TTTACAGCCCCTTGGCCAAATTAACAAAAAGAAGGAGAGAGAAGATTCAAAAATAATAAA
ATTAGAGCTGAAAGGGGAACATAACAACAGACACTAAGGAAATCCAAAGAATCCTAAGGA
CATACTTTAAAAATCTCTACTCCACCACACTGGAGAAACCTAAAAGAAATGAATACATTT
CATGCTATATCACACCTACCAAAATCCACTCAAGATCAAATGAGCAACTTAAACAAGCCT
ATCACCCCTAGTGAAATGGAAGCAGTAAAGACATGGCTTCCAATTGGAAAAAAAAGCCAA
GAGCCAGATGGACTCAATGCAGAATTCTTCCAAACCTTCAAAGATGAATGAATGCCAGCA
GTTTTTCAATTACTCTATAAAATAGGAACAGAAGAAATGTAGCCCATTCTTTTCATGAGG
TCACTGTTACTCTGACACCCAAACCACACAAGCATTCAACAACAACAAAAAAGTACAGAC
AAATGTCCCTTATGAACAGAGATGCACAAATTCTCAACAAAATACTTGCAAAAGAAATCC
AAGAACACATCAAAAAGATCATCATAATAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved