Mus_musculus Locus Mono:45:SNORA3
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:45:SNORA3
Mus_musculus
Mono:45:SNORA3
6
SNORA3
1001..1122
2122
TGGATTAGAGACTCATGTAACTTTAGGCTGGCCTCAAATTCATTTTGTAGTCAAGGCTG
ATTCCAAACTCTAAGACTTCTGCCTCCATCTCTTCATTACACCTGGCTTAGGGCTTTTGG
CAAACATTTTCAGCAGAGTATTGGACAGAATAGGATAGGCCCAACCCTCATGAAAAGAGA
GAGGGAAGGGAAGCTATTCAAAAGAGCAGTGCAGAAAAAGAAAGAAAAAAAAAGGAGGCA
GTTTTACAGAGACAGGTTACACAGAGAGAATAAGTTAGACACAGGTTAGAACAAGCCAGA
GAATGAGAAGGAGCCACAAGTTTAGAATAGATTGCCAGAGTTAGTTTGAGGCCAAAGCAA
AGCAAATAGTCAGAGGCTGAGAGAGAAGCCAGATTGAATCAGTCAGTTTGGAGAGGAATT
TGAGCCTGAACAGCTGAGTTATCCAGCTAGCCAGAGATCAGAAAGAACAAGAAAGAGTGA
GCTTATTCAGCTGTAAGTTTCAGAGTCAGAAAACATTCTAAACCAAGATAAGATTGTACA
AAGTCTAGAAACTTCCAGGACTAGGCCTAGGTTAGGGACTGAGGCAGTGAAGTCACAGAA
ACAACAATTATATCAGGTGAATAAAAGTCACATTTACAGTAAAGAGAGCTAGAGACATGA
CTCAGAAGTTAAAAGCTTCCCAGCATATACATCGCAATGGCTTACAACTCCAGCTTCAGA
AGATCTGACACACTCTTTTGACATTCATAGGCAACTACCCTCATGTACACATAGTCTCAT
GGGTACACATACTTTAAAAAACAACAACAATTTAAAAACTTTTGAAGGCATGGTAACGCA
TGCCTTTAATCTCAATACTCAGAGGCAAAAATATTGAGAGAGGCAAGTGAATCTGTGAGT
TTGAGGCCAGCTAGTGCTATATAGTGAGACTATTAAAACAAAACAAAACAAAACAAAACA
AAACAAAACAAAACAAAACAAGGACAGGAGACTAGAATCATATCCTGACATGGTGCTTTG
GTACTTTCCCTGGTGCTCCAGAGTTCTGGAGGAGGATCTACAGGTCTTGATTCACTGGTG
GAAGTCTTCAGTGCCCCTGTTAGTACCCAGACCAGAAACATGTCCTGTCTGCAAAAGAGC
ACAGGAAACTGAAGAAAACAATGATGCCAACCTCCGACCTCCACACATGCAGACATGAAA
GAACACGCCCAGCAAAACATAAAACACCTGCACACGCCGGGCAGTGGTGGTGCACGCCTT
TAATTCTAGCACTTGGGAAGCAGAGGCAGGCAGATTTCTGAGTTCGAGGCCAGCCTGGTC
TACAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAACCAA
AAGAAAAAAGAAAAAAAGAAAAAAACACCTGAACATAACACATCAAAAGATGAATTACAT
ATATATACACATGCATGAATATACATGTTTATAGGTATGTTTATAGTATGACAACTCAAT
ATACGTATACAGTAAACAGAAGGACACTAATTATTATAATTAAATATTCTTATAGTCCTT
CTTTGAATTGCAGTTATTTATTTTAACCCTTATATCAGAAAACCAGTCACAGGACATATG
TCAGTGAGCATGTCAATGGCAATATTTAATCCAACTGTACTTGTGGACACTTAGACTTGA
ATTTCATGCAACTTTTAGGTTTTACAGAATAGTCTCTTCTTTATTTTTTCCTTATAACTT
AAATATATATAAATTAGTCTCAGTTCATTGACCTTATAGAAAAAGGTGCAGGTTGCACTC
TGTCTGTGACCTAGAATTTGCTGACTTTAGACTTGTTCTAGACTTTAATTTTTGTGTCGC
CCTGATGAACTAATGTCAGGAAAGAGACTCACTACATAAAAAAGAAATGAAGGTGTTGGG
GGGGAGGGTTTGGGGGACTTTCGGGGTAGCATTGGAAATGTAAATGAAGAAAATACCTAA
TTAAAAAAATTAATTAAAAAAAAAAAAGAAATGAAGGTGTGATGGTTTGTATATGCTTGG
CCCAGGGAGTGGCACTGTTGGAAGGTGTGGCCTTTTTGGAGTAGGTGTGTCACTGTGGGT
GTGGGGTATAAGACCCTCATCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved