Mus_musculus Locus Poly:17:SNORA43
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:17:SNORA43
Mus_musculus
Poly:17:SNORA43
2
SNORA17, SNORA43
1001..1132, 2337..2475
3475
CACTCGGAGGACAGTGAAAGTCCCTCGCGGGCTGCCGTAGTCAGTACTATAAAGGACGT
GGCGTGGAGATGCTCGGCCTCTCGGCAGCCATGGCGGCTCTATGTTTGTATCGCCATTGT
TACCGTTGGGACGCCGCGGATGACCCTATATACCCTTGGCCGGCTACCGGGAAGACTGCG
TCTCCTGACGATCGTAACGAAGATGTACCGTGCTTTCCTTCTGAGAGTTTAGTCGCCCTA
ATATGTGCAGCAGGCTAACCGCGTGGTAAGGGGAAGGGCGTTCACGATGTGCCCGAGGGC
CGGGTGGACTGCCCCCAGAAGTCCCGAGAAGGAAAGCCGAGGCTCCTGTCTGGACTAGTA
CAACGCAGAAGCCCCTGGTTGGGGCTCCAGACCGGTCTCCCTTTCGTAGGGCTAAGGAGC
ACCAGGGAAAGACTCTGTCTATATTTGCTGCATGCTGAATACCAACTTGAGATAACTCAG
ATGTGAGACAGTACTCTGTCTAGTGTAATGCCGCTGAGTTGGAGAGAAAGAAAAAGGGGT
TTTATTTGTAAAAAGCCTAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGG
AGGCAGAGACAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAG
GACAGCCAAGGCTATACAGAGAAACCCTGTCTCGAAAAACCAAACCAAAAAAAAAAAAAA
AAAAAAAAGCCTTAGCAAGGACAAGCCATGTGGACCCATTGGAATAGGAATAAAATACAA
GTCTAGTGCAGTCCCCCAAAGTGATCCTGATAGGGTGTGTGCAGAATGCTTTCTTCCTTT
CCTTTCCCTAGGAAGCTTGCCTGCCAGAAAGAAAGCGCCTGTTGGGCTATTAGGTGAGTT
GGGCTATTAGGTGAGTTGGGCTATTAGGTGAGTTGACTCAAAGTTACTAAGATTCGCATT
AACAGTCACGGTGTGGCACCCAGCACTTGCTTCATCGACACCCTGCTCCTAGAGGCGTTG
CAGGTGTGGCTGCTGTGTCACATGTGCGTCAGTAGGTGGCAGAGAGAAAAGAGGCTATGT
CTACGCTCAGTGTTCTGCCCTGTGAACGTCTGAATGATTTGTAGCCTGACAACACTCCTG
AAAGCTGGAGGTGGGATTGTCCCTCCTAGTTTTTGACTGGCTTAGGTCATTTGATGGCTC
TGCATAAACCAAATAGAGGGGCTGGTGTGTAAAGAGGAAGTTTACAGAGAAATTGATCTG
TTGGAAATCATGAAACCAGGTCCTGGGACACAGCGTTGTGGCACATGTTTCTCTTATCCA
CCAGCTTGGGTCAAGAGACTGTCTCAAAAACAACAGTGGGTGGAAGCAAGGATGTATCTG
TCTTAGTCAGGGGTTTTATTGCTATGAAACACCATTACCAAAGAGCAAGTTGGGGAGGAA
AGGGGTTATTCCGCACACACTTACACTGCTGCTTGTTGCCAAAGGAAGTCAAGGCGGAGA
CCATGAAAGGGTGCTGAGTGCTCCGCCTGTACCTGCATGCCATAGGAGGCCATCAGAGCC
TGTTCTAGATGGTGGGGAGCTGGGAATTGAACTCAGCCGTCAGTGCTCTTAACCACCGAG
CCAGACTCCAACCCCAACCAAGAGGTTGGGTTTCTCTATGGCCTGGGATTAAAGGTGTGT
TCCACCACCAGCCCAGAGATGGCACCATTCACAATGGGCTAGGCCTTCCCCACTGTTCAC
TAATTGAGAAAATGCCTAACAGTTGGATCTCATGGGGGCATTTCCTAATGACTAACTTGT
ATCAAGTTGGCACAAAACCAGCCATTACAACCTCAAAGCCTCTCTTTGGGGAGATGAGTG
GAGCTTATTACCTAATGCTCCAGCTACCTTGATGTGAGATGGCTTTTCAAACTGGGTATC
TACTGGTTGCTAGCTGGTACGGGCTGGAGTGGAGCTCAGTGGTGCTCACTTGGCTGCACA
CAGGCCTGAGTCTCCATCCCTAGCACCATGGGCAAGTGAAACTGATAAGGGGAAAAGACG
AAGTGCCTGATGGTAGGTCCATGCAGCACCGAGATTTCAGAATGAGGAAGCATGGTGGAG
CATACAGCTAACAGTGACAGGGGGTGTCATAAAGCATAAGGGTAAAGGGACTACTGCTTC
GGGCCTCCAGAGGTCTGGGGGTGCGACACTTGTGGAAGGTCTACATTGATTGTTTTCTTT
GGTACAGGAAAGTTGGTGACTAAAGTCTGCTTATGCCAAATGCCCAGCAATGTCCAGTTG
AGGTAAGAGGTAGGCTGGAGCATGCTCAGATGGGATGTGAGTGGCTGCCCTAAAGATGCT
GTCCTAGATCAGCACCACAGGCATGGCACAGCTGCTCAGCTGAGCCTGTGACATTGGGGC
AAAGAGCAAGTGGCTGTTTCTACGCTCAGTGCTCAGAAGCCCGTGAGCACTAAGAATGGT
TTGTAGCCTGACATTTTGCAGAGCCGTGGTGGGAAGGCACTGGGTTTTGCTTTGATGCTG
TTGGCCAGACCCCAGTGTCAAACCTCTAGGGCTCACCAAAGGGTTGCATGGTCAGCATTT
TAGGGAGATAGAACTTTGGAAGTGGAGGGAGATAGAAATTAAGTTTTCTAGGAGACATCC
TGAGGGACTGGAAAAATACAAGAAACTCTCCATTCCTTTCATCTTCCAGATCCAGGAGCC
AGGAAGAAGGGGGGCTACTTGGCCAACATGGCTGATCACGTGCCTGAGGTATGCCCTCTG
ACCTCACCAGGGTAACACAGAACCATCCATACAGGCCTTGGGCAGCTGGAAATTTACACT
GGTAGCTCTCCCATGTCCTAAGTTAGGAACTGGATTTGGATTGGCTTGGGTTTGACTCTT
ATTTCCAAGACTGGTGAGGTAAACACTGGATGGAGGACCCTCTAAGGCTCAACCTCTCTA
TCTAATTGTATATGGCCTTAAGAGAGATAATTGAGTTGGGTGGTGATAACTGGTCACTTG
AGTTCAAGGCCAGCCTGGTCTACAAAGCAAGTTCCAGGACAGCCAGGACTGGTACACAAA
GAAACCCTGTCTTGAAAAACTAAAAAAAAAAAGGAGAGGGGAAAAAAGGCTGGATGCTGT
GACACAAATAAACTTGTCAGTTCTTGAGGCTGGAATCTTTCTTTGCTGTCAGCACTCTCC
CACCTTAGGCTAAATAGCCTACTGAGTTTCTTCTCATCTCCCCTGGAAAATAAAACATGC
CAGACTAAGGTTTAAAGGGAGCTAAGCTTTCTGTATACTGTGGGCAAACATTTTCCCTAA
GCTAAGCTTAGAAGGCTGGTCTGTGGGGGCGCCAGGTAAGGCACGAAGACAACACAATAG
AAATGCTGGTCTGCTCAAGTGTCTGAAGCCCAGACTGGGGCTGCCACTGTGTGCCATCCA
GGATATTGCTCAGTGGATCGAGCATGCTGCTGAGAGATGCACAAGAGTCCGTCCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved