Mus_musculus Locus Mono:378:SNORD60
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:378:SNORD60
Mus_musculus
Mono:378:SNORD60
17
SNORD60
1001..1078
2078
AATCCGGTTCTCCGCCGACTTTCCAGAGCCTAGGATACTGCTTGGCACACAGGCAGCGC
TCAAAAAAACATAGGAGTGCAAAGACAACGAAAGAGAGAGTGAAGGGAAGGAGTGACAGA
CGGATTTACTTGGAGTCAGGAGGACTTATAGAGGCTGAGACCCCAGCCGTCTCAGTCCCG
CCCCCCAGGCTAGGCCCACGACCGCTCGCGACGCTCCCACAACCAGCCCGCGCTCCACCG
CACTCCCCGGAAGAAGGAGCCCCAGGTCTTGTGCTCCGCGCACTCACTCACCCGCCCGCG
GCTGCCTAGGAGCAGCGACTTCACCCACCGGCATCATCTTGCCCCTCTCGGCCCGCGGCC
GGGAAAGGTTTCAGGATACAGGAGCCGGAAGTCCCGGGGCAGGTCGGAACTTGTAGTTCA
CGGACTTCAGGAACTCTAGGTGCTGCTTCACGCTTTGAGCTTCCTAAACTACGACTTCCG
GCGACCTCTGTACTGAAGGACCGGATTGGTAGCTTCAGAATCACTCTATGTTGCACATTG
GAATTTGATTGGCTAACTGAACTCGTCACTCATGGACTCAATGGCTCTACAACCGGGAGG
ATATTCGAGCTACTCAAAATACCGCCTCCAAAACAAAAGTCGCTGTACGATTGGTGGAAA
TTGCAGGACAGCTCGAGGAGCATATCAGCAGTGGAGGAAGGTGGGCACTTCCTCAGAGGT
GGCCCAATCACATAAGGGGCAGTTCTATAAACTCTTGAGCCTCGCGAGCAGTCGCTCTTT
TTGGGAGTGAGTGTGTTCGTGGTCCCTTTCATCTAGGTTTTGTAAGGAACGTTTTGGGAG
TAGTGCTCGCCGAATGGAACTCAAAGGACCTCTGCTACAGATCTGCCTTCCTCCCGAGCT
GAAGTGCTTTAGTCCTAAGGGTTTAACCCTTCCCCATTTTTCTTCTGACTCCATTTTTGC
AGGTATGAACTGGTCGGGCCTGGCTTCCCTTTTCAGCCCCAAGCCCGTGATGAATTAATT
TCTGACACCTCGTATGAAAACTGCATGCGTAGTCTGATTACATTATAAGACTGAGGCTTG
GGCGCGACGTCACTAATTGGATGGGTTTTGAGTGAAAAGTTAACCAAAGTAAAGATTTAT
GTTTGATTTTTTTTTTTTCAGGGCATGTTGAGTCGGCTGCATCTAGAGATCCAACGAGTA
GGAGTGTTGGCTGGTAAGCTGGGCATCCGTGTATCTGAGTTTCTTAGCAATAAAGTGAAA
TGCAATCTTACTGTGGTTTCAGACGTTGTGATTTCATGTGCTGATAGCACAGTGCCGTAG
AGGCCCTGGTTTGGCGTCACACAGTCCGCAAAGGGGTTGACTAAGATATTCTGTTTGAAT
CATTCTAATCTAGGGTGACCTTATAAGCCAGCACTACTTAAGGAATAGGCTGTGGGGCAC
CCTAATCTTGATAGTAAACTATTCCTGTGGGAATTTTGGTGACGGTATCAGCGCATGTGT
AAATTAAGTGTTTCCCCAGGTGAAGTACCTTTACCCCCCCACTAAGCCATTTTTGCCCCA
GGAGGTGGTTTTCCACAGATGACACAAACTCCAGAAACACCTTTATTAATAGGGACTTAG
AGGACAGGTTTTCACTCAACATTTGTGGCTTGGTGACTTTAGTACAAAGTGGAACGGACT
GGGCCAGCCTGCTAAGTTGTGACTGGGTTCTATCATTCTGACCTTGCTGTGCGTCCCTAT
ATCAGCCTCCTAGTGAGTCGGAAGCAGTCCAACAAATGGACAGTGACTGACATAGCCTTG
AGTGGGGTCCTGTCTGAGCAGTGTGCTGCGTGTGGTCCCCCTCCTCACTTCTGGGAGTGC
CCAGAAGAGGGCAGCAATGTGCTGTGGCCTGGTTTTTATGCTTCAAGACCATTTCTGGTG
GCCACTGGGGCAAAGGGTAAGCATTAGCCTCTGGTGTCTTTGAGAAGACACTAGGGCATC
CATCCTTTGAGGACAAGTCTATAGACTCGGGCAATTCTCAAAGGCAGAACTGCTTCCTCC
AGCGTGGAACTGAGTTTCAGCAAGGTTCAGAGTCGACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved