Mus_musculus Locus Mono:138:SNORA70
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:138:SNORA70
Mus_musculus
Mono:138:SNORA70
8
SNORA70
1001..1103
2103
TTCCCATCTTGGTTATGCATGTGTCATAACAGCCTCCTGCCATCTCTGATTGGCTTGTG
TGCTTGCAACAAGGATGTTGATGACCTGAAAGCTTGCAGCAGACACTGCACATCTTCCTC
ACTATCTGAGGCTGATCTGAGCAGTACCACACTTCTTCAGGTCCACTGACTGCCTCTGAA
CCTAGACGTGTTGGGAGAGGGTAAACCACTCACCCTACCACATGCTTCCCAATGGTTAAT
GATTAGGCTTCCTTAACTAGTTGGGAAAGAAAACTATGGGAAATGATAGGAAAAACCTAC
CAACAAAGGATGCCTTCTGGGAAAGAGTTAGAAAGGAGTCAGGCATCTGAGAAAGTGACA
CTGCTGACTGTCTTGTCATACATTGGATGAAATAAAAAAAAAAAAAAAAAAAAACCAAGT
GTGGAAATGAAGTAAATTGGTTCTAAAGCTGACGAAGAGCCTCTGGTTGGTTTGCAGGAA
GGATATCTAGATGGCAGAGGTAGAAGATTGAGATTCCATCATAAAACAACCAAACTGAAC
CAACCAACCAACCAACCAACCAACCAACCAACCAACCAACCAACCAACCTCTGTCCCTAG
ATGTTGCTTTGGTCCTGCCAAAGGGATCTGAACTCAAAATGTTGCCCACATTTTCAGTCA
GGCTGACTCTGAACATAGAGTTTCCATCTACATTCAGAAAAAGTTTGTGTTCTCTAATAA
TTAGATACTAACACTAATGCATCTGGGAAACACGGTTTTATTTTTAAAATTATTAGGTGT
AGGGGTATTTTGCCTGCCTAGATGACATGAATCATGGGTGTGCCGTGTGCACAGAGGCCA
GAAGATGACTGTTGTCTCCCGGGCACTGAAGTTACAGGTGGTCATGAGTTACCAAATAAA
TACTGGGAATTAATTGAACCTGGGTCCTCCGGAGGAGCAGGATCTTAACTGCTGGGCCAT
CTCTTCAGTCCCAAAAGTATTTTTTAAAAAGGTGATTAATAGTGCAGCTGATTAAGCTGG
CCAAGTTCCTTTCCCCGTGGGGCTTTGGTGTGCAATGGTTGCAAACAGCTATATACGTTG
CCTCAAGGGACCTTGGAGACAATTTTTTAAAAAGTGATTAATAGCCATCCAATGTGAGGA
TCGGTTAAAAGGTTAAAGGACCCAGGATGCAAGTGGATTCTTTCCTTTGCATTTTTTGGA
AGCCGAGAAGAGACATACTAGGTAGGGTTCAAGCAGCTCGAAAAGGGACCTGGAGGCCCC
TTCGCTTCTTCCCACTGTCCGTGAGTTTTGCTGTGCGTCAGTGCCAAGTCTGATGCGTAC
GGGGGTGGGGGTGGGGTGGGGTGTGGGGTTAGACATCATCCAATCCCGTCCCTTCGTCTT
TTCAGGTATGCAGATGGAGGCCAGAATTAGAAGAACTCAGGCGTTGCGTGTGGGATTTCT
CTTCCCATGATGCTGAGCGGCCAGTCTGATGTATTGACCTGTTGTCTTATCCCACCACGG
CTAGGGTCAGATGAAAAAGCTCATCTCCTGTCTCACCCTGTCCCTGCAGCTGTAGTCCCT
TTGGATGGACTCCGACTTAGGGGTAGATGTGAAGCAGGGCTCTTCAGCTGCCTTCAGCCT
CATCTTCGGCAATGAGCTCTGCATACTCGGGTCCCTTGCCGCGTCCTTCCACTCCTCACA
CTCTGAACTATCTGGGGCTCTTCCAGGAAGCTCTGCACTGGGGCGGAAGTTTCTACCTGG
AATGGGACTAATATTGGCCACGGTAACAGGAAAGGGCTTAGTGACTGCCTGAGGCAGCGC
AGGCTGCCCAGGTCTGCTCTCTACCAGAGTCTCCGAGTGGGATATCCGCAGAACTACTGG
GCTGCCTCTTTGGTGGGATGTGGTTCTGTCCATGGCGGCACTGAAATACAGTGTTGTGCT
CTCCTGTCCTTCCTTCCCCTGCAGGGGACCTTCTGTCTCCTTCCCCTGAGCTGCAAGGTC
AGCCTTGGACCCAGCCAGCTTTGGACTGTCCTCCTGGGTAGCTGGTGGCTTCTGGGTTGT
TGCATTGTCCTCAAGCTCGCTGGCAAAGGAGAGATAGCTTGAAGTTTCCAATGACTCCAT
CTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved