Mus_musculus Locus Mono:342:SNORA28
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:342:SNORA28
Mus_musculus
Mono:342:SNORA28
9
SNORA28
1001..1105
2105
CTGATGCTCCCTCGGAACCAGGGGTTTGCACAGGGTTGTCTCATTGAATCGGAGAACGC
ATGAGTGCCCCCCAACCTGGTGGACAAATGGCTCCAGCAGGATGCCCTTGGTGCGGGGCT
CCACGTCCATGGTCCTGAAGGCTGGGCTCATCCTCTGGACACGAGCAGCAGGGAGAAAGG
GGAGGCAGCGGGGTCCAGAGGCCGGCTTGCCCTCCGTTCACTGTCTGTCCTTACAGCCAC
CTGTTTGATCTCAGCTCCTCGGTTTGTGCAGGCCAGGACACTCTGGCGGAAGCAAACACA
ATGATGACATGAGGTTTGGAAGTAGCCTGGGAACCTCCTTGCAGTCAGTCAGTCACTGGT
CTTCTCGGCAGGAAGACAAACGCCTGAGCTTACATAGGGCTCCGCCCACACTGCCAACCC
CTGCCCCGCCTTCTTCCAGGAGAGACAAACATAGGGAGAGGGAGGGTGGAGTACGGGTGG
GGCAAATACTGATGGGCAAAGACTGGGCTCCAGGGGGCCCCTAAACTGCCAAACCTGGCC
ATCACAGCAAGCAAAACACAAAGCCACAATGGCGTAAAAGCACAATTTCCAACACAGTAT
TCAGATAAAACCTTACAATTTTATAATTAAGGTTGTCATGCTTAAAGATAAATGGTTCCT
AAATTACTCTGCTAATTATATTTTTATAAAGTGGATTTTAAAACAGGGAAAACCAGTTGT
TGTATTGTTTAATATGATTGACTCTCTCAGAGTGTCCACAAACACTGTCCCTTGCCCAAA
GCCAAAGCCAAGCCCCATTAACCTTATTAGCAATGAAGCACTGAACCCGCTTTAATGATT
AACGTCTGTATCTAAAAACAACTGATTGAAGCTGGCTAACTCCATTTAAAAAGATACACA
GTGTTCTAGGTCACCAACTATTTTTATCAGTTCTATCCTGATCACCAAATGCCTTTAAAC
CAAAGTTGTGAGGCAAAGTTGAGGCAATCTGACTATAAGAATGCATACATTCTCTGACAC
AGTTTGAGCTTACTAAAGCAACAAAGTCTAACCTATTCCAGTGCTCTCTTTCGCATGAGG
CAAGCTGTCATACAGGCTCAAAGAAAGAAAAAAAAAAGCAAACATTCTAGTATTCCAACC
ACCTCTCTTTAAAAGATGGGGCCCTGTTATTATGCCTCAGGACTTAACCTCTTTCTCTGT
TTCTACAGACTTCCTGAGAAAGCAATACAAAAGGAAAGCTACTGACTCGTGAGCAGCTGT
CAGAATCACATAGGTCAGGGACCATACTTATTAAACAGTCAGAGTCCGGCATGCTCCCCA
ACGCACAGGCCAGGGAAACATAATCCAAAGTCTTTGTCAAGATATAAATCTGCTTTCGCT
CCAAGAGTAATGCCAGGTACCAGGCCCCACAGTTGGGAGGTTGGGGCAAGAGGACTGCCA
CAAATTCAAGGCCAGTTTGAACAAGAGTTTTCCAAGTCTCTTGAAACCATTTCCCCCCTA
GAAAGAGATAGCTCAATACTGTCCGTATAAGTCCAACATACAAGCCATGAAAGATGGGAA
GGAGAGAACGGATTCCATAGAATATTCTCTGACCTCCACATCTGTGCCCATACAAATACA
CATCACAAATACATTAATAATAGTTTTTAAATACGCCCCGAAAAGGCAATAACTTAAACA
AGCTGAGGACTTGAATAAAATCCCCAGAACCCACAAGCTACACAAACACCGGCCTTGGTA
AATCCTGCTGGCAACCCAGTGCTGGGGAGGCTGAGATGGGAAGAACCTTGGCCTCACGGG
CCAGACAACTTAACCTCGTTAGGGTGCTCAAGCACAGAGGCCCTACCTTGAAAAACCAAG
GTGAACAATTCCTAGGAAAACACCAAGAACTGACCTATGGATTCTATACTTATGTGCACC
TGCACACACATATGCATCCATATAAGCATGCATGCATACATGTGTGGCACAAGTGTACTA
CATCACACATGCACACACTGCATACTACTCAAATGTATTCAACTACAAAGAGTATCTTTC
CATCTACCCCTCCAGTGAAAATTTCCCAATGGTCCCATGGCATCTCTGTACAGTGTGCTG
TACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved