Mus_musculus Locus Mono:256:SNORA70
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:256:SNORA70
Mus_musculus
Mono:256:SNORA70
15
SNORA70
1001..1123
2123
AAAACACGGTATCACTGGATTCTTGACAACAGAAAAATGAAACAAAACTGTACCCCAAA
GTAGTCAGAGGAGCCAAGTGGTGGTGGTGGTGCCCACCTATAGTGCCCAGGAGACTTAGG
GTAGCAGGAATCACTTAAGCCCAGGAGCCTAAATAATACAGTAGATCCCATTTTTGGGAA
AAATAAAATGTGTGTTGTAACTCCAATTCCAGAGGTCTAACCCCCTCTTCTGATCTCTCA
GGCACCAGACATGCACCTGGTACATAGACATACAGAAGCAAAACACTCATACACATAAAA
TGAATCTAAAAAAGAAATTTTAAAGCTTCTCAAAGAGAAAATCAAAGACTTAAAATTCTG
AAATTAGGTTTGCACCAGTACTCTAAAACTATCTAACTGTGTTTTAATTTTAAACCTGGT
ACAATCTAATGATTTTTCTTGGGGGAGGGAGGTGCTAAAAGCTGGACGTATGGCCTCACA
GAGACTAGCATGCTAAGCGAGCACTCTACTCTTTGCTCCAGATCAATGGTCTTATAAAAT
ACAATAAAAAAGAAGTTCTAGTAAAGTAAACTTAAAAAAAAAATCAAAGTTGAGTGAGAA
TTTCATTTTTATCATTAATGTTAATAAACGGAAAATGTCTGCAAGGCTGCTATAAAGTTT
TCCGAAAGCTTACAGAAAGTCACCACCTTGTGCCTAGTTTAGACTAGGCACAATCCCAGT
GCCAACATTAGTCTGGTATGCCATGCTTAACAGCATCCTGGCTGAGCACTAGAGACTCTA
AATCCTCAACCAGACTGTCAAGTTGAAGTCGGTTTAGCCAAGAATTCAACTGCTTACAGG
ACCAGCCTGCTGCCTGCTTTGGGTCTCCCTTGAATCAACAGGAAACACCTCTAGTGCCCT
AACTGCCTATACTTCTTGAAAAGGTTGAGCAGTCTTGAGTCAAAATGGGAAGATCTGAGA
GTCAATCTACAATTGGCTTATAAATACTACAGAAGAAGTATTTGCAGCCAATTAAGCCAA
GCAGGTTCTTTTCTTCATGGGAACAAAGGATGCAAACAGTGGCTTCTGCAGTAGTGTATG
CAGCATATGGCTTGTATGGGATTTCCTACGTCTTGGAGACAACTTTCTGGTTAATCTTCC
CATCTCTCATCTCGTGCTGTCTCCGGTCTGACTCCACTGGCGATGTGTGGTACTTTTGAG
AAGCTCAAGGACAGTGGCCAAGGCTCACACTGGTCACAAGGTTCACAAAGGTCATCATGC
CCATCCACACCAAGATACAGAATACAGAATGTGTGACTGAGTTGCTGTGTAAAGCCAAGT
GCAAGTTCCCTGGCCACCAAAAAATCCACACCTCAAAACAGTAGAGCTTCACCAAGTTTT
ATGGAAATGAATTTGAAGACATTGTGGATGAGAAGCAGCTCACCCCTGATTGGCTATGAG
ATTAATAAATACATCCATATGTGTAGGTCCCTGGGCAAATAGAAATCCCTAAACACCTCA
GAGCATTTAGAGTGCTGAGCCCTACCAATTATTTATGAATAAATCTCTATCTAGTGGAAG
GGGCACCAGAATACAAGGATAGACTTCCCTCTTTTATAATCACTGCAGATCACACAAAAG
AAACAAGTGACTGTCACTTCAGAAGCAGAAAAGTAGACCAACCAAAAAATTAGTCCACAC
CCAGGCTTTAGAACAGGAAGAAATTCTGGACTAAGGGCAAAGAAAGAGGAAGCTGAAAAA
AAAGGAAAAGAAAGAAAAAAAAAAAAAAAGCTGAGTAACCTAGGAGGAACTACCTATAGA
ACCATGCAGGAGAGAGACACCTTATGCATCTGGGTGTTTGAATTCATTTGTCTAGTGGTT
CATAAGGGAGAAAAATGGGTGATTTCTAACCAAGGATCACTATCTTACCATTTCAATATC
TTAACACTAACTTGCAGCACTTTGCTTTTGCTTTGAAAATCCTGTTAGGAATAAAAATGG
TGTTAGAACACTATACAACTAAGTCAAGAGAATTCCCAAGTTCTCACCACTCATATTTTG
GGCAAGTCATTTACCTCACTCTGCATGAAGATACTGTGGCATCACTGATCCCACAGGACA
ATGGCAAGGACTATTGATTCAACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved