Mus_musculus Locus Mono:443:snoZ30
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:443:snoZ30
Mus_musculus
Mono:443:snoZ30
11
snoZ30
1001..1097
2097
TATTATTAGTAAAGGGTGGATGTTGAGAAGTTAGAGATGGAAAAATAGAAACCTGGTAT
TCAGACCTTCCTAATTCTGCTATTAAGTGGTATAGAGCTTTAGAAGACCCTAACCTCTCA
AGAAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGTTTCCTTCAAGCTATTTTTTTAAA
TTAGGTATTTTCTTCATTTACATTTCCAATGCTATCCCAAAAGTCCCCCATACCCTGCCC
TCCGACTCCCCTGCCCACCTACTCCCACTTCTTGGCTCTGGCATTCCCCTGTACTGACTC
TCAAGAGTTTTTGACTGAAATTAGGAGTTTCTGGTAGGAAAAAAATTATGATGTAGAGCT
TTGCTTGTTCACTGTACACTTTCCTGTGTTGCTCAGGACTCCTTGGCTCCCGTCTTACCC
ACTGGAGTAGCTGGAACTGCAAGCACGAGTCACTGTGCCCGACATTGTGACTATGTCTTT
TATCTTCCTTGGCAGTTGAATTCTATGTTAAATGGATAATAGGAAATCTTTTCTACAGCT
ACTACTTTTTTAGACTATGTGTCTCTTAACAAATATCCCTAAGATTTTGTCAAAATAAAT
GGAGGTTGGACTCATGTAAATAACAACAAAACCTTTTTGTTGCTGTTTTGAGACAGGGTC
TTGTTATGTAGCTCTGAGGGCTGTCCTGGAACTCACTGTGTAGAACTCAAACTCACAGAG
CTCCTACAGCCTCAGCTTCCCAAGTGCTGAGATCAAAGATGTGCACCACTGTGCTTGGCT
CTAAAAACTTTTTTTGAGTGATAAATGCTTCTCCACTCTGTGTTGTGAAAACAAAAAAGC
CCCCTACCCACAAAAAACCCAAAAACTTGTTTTAAGTTTTTTATTATTATATAGCAGTTA
TTTACCACATAGTGGAAAGTATTGAAACTTCAAAGTTGAAGCATGTGAGAGTAGCTTTTT
GAGTGTGTAAGCCTACATTTGACTGGATGTGAAATGGAGCCATGCAATGATGAGCGAAGT
ATAGTCTGACCTGGTATTGCCATTGCTTTGGCGCTGGCTCTGACCAGGGTGTGACCCCTT
AATCTTCTCTCTGAGCTGATTCTGCTGACCACATGGGGGTATTTGAACCTATGTGGATCC
TGGCTTATAATGTGTAAGAGTATTTCTTTTGTATCCTTTGAATTACTGATACTTTCATGT
TTTCCTTCTTAGGTCCAGGTGAGAAATCAGGGTTGAAAACTGCATGGAGGATTCATCATT
TCTGCCCTGAATTGGAATCAATTCCTTATTGACTTATTATTACTGTATTAAAAGTGTTTT
TAATTAACCATGGTATTTGTTTGGGTAAGATCTTTATTTTGGTAAGTTTTTACCAGAGCT
TATAAATGATCATATACTCTTCTTCTGGTAAGCTTCAATATTTTTAAATCTACAAGATGG
CTTATCTATTTTAAACTTAGTAAAAGTTATATCATGTTCATGGTACCAGCGATTATGCGC
TCAATTGCCAGCATGAATCACAGTAGGCACTTGGAAATTATTTTCATCTGGCTTGCATTA
ATGATTTTTCAGAAGCTGTTTCTTCACCAGCTTGTCCATCCAATGTCATAAATCTTCCTA
AACAAGCAACTAAACTTTTGTTTCTGGCAAATGTTATTTCATACAAGGTGGTATCTGTGC
TGTTAGAACAGGATTTTTGTTCTAATTATTGAATTTGTCTTTTTAAAAAGCAAAACTTTA
ATAGATACAGAAAAACTTCAAGAAGTCAATGGTGATCTGAACGGAAATTTATTTAAACCC
CTGAAGTAATCTTTTGGGTTTCCGCATAATCATGACAGCATGGAACAATTCTTTCCCAGA
ATCATGTATTGTTAAAATTGACTTAAATGTTTCATAGAAACTTTCATAATACCTAGCATG
ATTCATATCAACTGAGCAAACTGCCAGTTGAGCAAACTCATGAGAGCAAGCAGAAGGCTT
CTGCCCTTCATTAACTCTTCACTAGGTAGGCATCAGGTAAACATTAGATAAGGATTTTAC
TGCATCTCACCATTGCCTGCTAGTTTTCATTCATACTGAAATTTCCAGACTCCTCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved