Mus_musculus Locus Mono:195:SNORA67
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:195:SNORA67
Mus_musculus
Mono:195:SNORA67
X
SNORA67
1001..1143
2143
ACCTTTAAGGAATATGTCTAAATTACCAAGGCAATGTCATTTAATCAGACAAGGCAGAT
GTGACTTTTCTTGGTTCTGATAGTTCAGAGGATCTCCACTTTCCTTGCAAATATTTCATT
CTCTTCCATTCATTTAAAAAATTCGATTAAATGTTTTAAATGAAAATGAAGGAAAGCTAT
CATGCAGTGGTACAGACAGTGGAGTCCTTCCATAGGGAAGTGAGGGTAGACACAACAAGT
GCTGAGCACCATGGCCAGGAGCTGTAATCACAGCACTTCAGAAGTGGACTTTTGAATGAA
GTGGCCCTCGTTGGCCACACAGCAAGTTCAAGAACAGCCTGCATGCACTAAATGAGGCCT
CCATCTCACTTTTAAATGTGGGGCTGGGAAATGGTTCAGTAGGGAAAGTGACTGCCAGCC
AGCAGGAAGACATGATTGTGACCCCCAACCTAGATGTAAAACAGTAGCCAACATTTCAGT
CTGGGTTCTGAGACCGAGAAAGTTGGCTTCAAAGAGGGTGCTGGTCATCCTGCCAAGTTA
TAACTATGGGCTGACGTTTAGAGACATAATGGGATCCAGAAGAGGCTAACCTAGGGCTGG
CTAGAGAGATGTCTCTGCAGTAAGAGTACATGCTGCTCTTGCAGAGGGCCTAAGCTTGAA
TCCCAGCACACAAAACAGACAGTCAAAATGCAGTGTAACTAAGCTCCATGTGATCTGACA
CTCTTCTGGTTTTTACAGCCATCCACATATATGTGCACAAACCACCCTCAGGCCCACATA
TATGCACATCATTGATAAATGAAAATCAAGAGTCTGGAGAGTATGTACTTGTCTTCCAGA
GGACTCAGATAGACTCCTGTCGACCTCCTGCACCAGGAGGCTCACAACCACTTCTCACTT
CACCTCCAAGAAACACAACAGTCTGCCTCTGTAGGCATCTGTACACACACACACACACAC
ACACACACACACACACACTTGCAGTTAAAATAACAAAAATAGTCCAAGGTGATTCCCTCT
CCAATGGTCTGAGTATGTGCCTTTTTCAGGAATGTAGCAAGTTGGAAGAAAACCAGGCAT
GTCTGAGGTCTCTGCTGATCAAGGAACACTTGTTTCCTTAGCCCTCCTCTGGCTGCCTAC
ATGTATGCAGAAAAAAAGAAAAAAATAACAAAAATAAATTTTTATATATTTTTATTATGC
ATTTTCCTAATTTACATTTTCAATGGTATCCCAAAAGTCCCCCATACCTTCCCCTCTCCC
CTACTCACCATCTCCCTCTTTTTGTCCCTGGTGTTCCTCTGTACTGGGGTATATAAAGTT
TGCATGTCCAGTGGGCCTCTCTTTCCAGTGATGGCCGACTAGGCCATCTTCTTATACATA
TGCAGTTAAAATAAAGAGCTCCGGGGTACTGGCTAGTTCATATTGTTGTTCCACCTATAG
GGTTGCAGATCCCTTTAGCTCCTTGGGTACTTTCTCTAGCTCCTAAATTGGGGGCCATGT
GATCCATCAAATAGATAACTGTGAGCATCTACTTATCTGTTTGCTAGGCCCCGGCATAGT
CTCACAAGACACAGCTATATGGGATGGAGAGATGGCTCAGCTGTTAACAACAAAAATAAA
TTTAAAAAAAAACTTACAATAATATGCAAAGCTAGAGGTTGTCGCTCAATGTTGACCTCT
GCCCAGCCTTGTGAACAGATGGGTTCCTATCTTGAAAATACATGTGTAAACACATGGACA
GACAACACATGCATAGGGTGAAATTGTTTTTAATTAAAAGAGAGAAGTCAGTCATGTATT
CAGATTGAAACACTAAGCTTTTAATACTTCCACTATAAATGTTGTAAAAAATTAATGGAA
TTTATAAAAAAGGAATTAGAGGAACTCATGAGAAAAGTGTTGACAAAGGTTATCAAACTG
TTTTCCAATAACAAATAAAAATTCAGAAGAAATAAAAAATAAAAAAATCTATAAATAAAA
AATAACATAAGGACTCATGAGGTAGCTGTGAAAATAAAATATCTTACCAGCAGTTCTAAT
GACCCGATTTCCATACCCAGGACCCAAATAATGGAAGGAGAGAAAGTTGTCCTTTGATAT
CCACATAGGAAGCACTGGTCCCTTCCCCTCAGCAATAAATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved