Mus_musculus Locus Mono:173:SNORD58
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:173:SNORD58
Mus_musculus
Mono:173:SNORD58
14
SNORD58
1001..1070
2070
GTACTAAGGCTGTGAAGTATTGTGAAACTCACCTATATACACCTCTCTACGTGCTCAGT
TCTTAAGGCTTCCTCTGTATTTCTGCTGTTTCCAAGACCATCTCACCCAGGCCGACTTTC
CCATGATTCCCTCTCCCTTTCCCATTCACTGCTAGGCCCTGGGGATACGTTAATGAACAG
TAATAGATGTGGCCTCTGTTCTGAGTTTTATTCTTAGGCAGAGGAAAAAAAAAATTAGTC
AAACACTCATAAACTTGGTGTGGCTGTAACAAGAGCTACAGATACACTCCTGGAAAACAA
CGGCCTCACAACAGGACATGGAGGAGACCAGCAAGAGCGGGGAAACAGGGTGGCGGGAGT
GGGAAAGGATGAACAAGAAACATGATGCTATGGATTAGGGAAAAGGTGAGGCAGAAAGAA
GGTATACAGGCAAGGGGAGCATGGGAGAAAAAAGGAGTCCAGTGTAGAGAACAGGGAAAG
GCAAGGAGCACTGAGTAGAGGCAGGACAGACAGGACCCACCCATCTTGGCCGTGTGGGTT
TTATTTTGTCATTACCCTAAAACGGAGCCAGAAAGTTTCAGAGTATTTTGGTTTTTTGTT
CATTTGCTTGTTTTTCTGAGACAAGGTCTCTCTTCATAACAGCCCTGGCTGTCCTTTGTT
CCTTTGTCAACCAGGCTGGCCTAGAACTCTCAGCGACCCACCTGCCTTGGCCTCCCCAGT
GCTGAGATTAAAGGCATGAGCCACCATGCCTGGTTTGAAATGGTTTAAAATCGAGAACTT
CCATGGTTATGTTTTGAAAAGACTGATATGGGTGTTGTCTGAACATGTGATTACAAAGGC
TCCAAGTTCCTGTGAGTAGACAGAGGACTGTTAAAACATACCAGAAGCAAGATCGGTCTA
GCTTTGACAACAGTGATGGCAAAAGATGGAGAGAAAATGATTCACTGTACAATAGATATA
CTACACTTGTCAATCACAGATCAAAGCAAACATTATGGCCTCTGCGATGATGTCATTCAT
ATCTTAGGACACCTTTGGATTAATCATGAAAATAACTATCCTCTGAGCAGCTGTTGGTAG
TTTCAGCCTCCTTGGTTACTACTAGCTGCTGTGATAGTTACTAGCTGATTGTGTTAGTTA
CTAGCTGCTGTGTTCACAGGTCACCTGCCAAGATGGTTCACTATTCTCTTGACCCAGAAA
ACCCCACAAAATCATGCAAATCAAGAGGTTCAAACCTTCGTGTTCACTTTAAGAACACCC
GGGAAACTGTGCAGGCCATCAAGGGTATGCATATCCACAAAGCCACCAAGTATCTGAAGG
ACGTCACTTTAAAGAAGCAATGTGTGCCATTCCGGCGGTATAATGGTGGAGTCGGTAAGT
GCGCCCAGGCCAAACAGTGGGGCTGGACACAGGGTCGGTGGCCAAAAGAGTGCTGAATTT
TTGCTGCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGAT
TCTCTAGTCATTGAACACATCCAGGTGAACAAGGCACCTAAGATGCGCCGACGAACCCAC
AGAGCTCATGGCCGGATTAACCCATCCATGAGCTCCCCCTGCCACAGTGAGATGATCCTC
ATTGAGAAGGAACAGATCGTTCCAAAGCCAGAAGAGGAGGCTGCACAGAAGAAAAAGATA
TCCCAGAAGAAACTGAAGAAATAAAACTCATGGCCCGGGAATAAATTCAGCATAAATAAA
TGCAGATAAAGTTAAAAAAAACATTATGGCCTATGTTACCAGACAGATATGAGACTACAT
TGCATTGATCTTAGCTATTGTTTTTTGCCTACATAATTAAGAGAGGCTGTGTAACCATAC
CGTTCATGAATTGTGTTAAAAGTATTCTGAAACTACTAAACACAAACTATTGATCAAGAG
GAGAACTGAGAATTGCCAAAAGTTCTAAGAAAAATGGGAGAAACAAGGGTATGGAAGCAC
CAATGAAGAGGTCATGCTGAAGAGTCTGATAGACCAGAAAGAAAAATGATTGACTCCCTG
GCTGCAAATCCTATCTTGCAGATAGGATGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved