Mus_musculus Locus Mono:154:SNORA9
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:154:SNORA9
Mus_musculus
Mono:154:SNORA9
8
SNORA9
1001..1133
2133
GCATGCCACCATTCATATAGCCGCAGAGGTTAGGGGTGGAGTAAGGGACTAGGAGGGAG
AGGATGAACTCCTAAGGAAGGGGAAATAAAATATAAAATATATAGTCATAAGGAGACACA
GGGGGATGCTGGACTAGGAGGATTACAAGGGAAAGAGAAAGGAAGAGAGTGTGCAAGGGA
GAGACAATTAACGCAGGGTCATACGCAAACCTATTACTGTAGACACTTCTTAAAATTTGT
ACATATATGAAATAAATCTGAATGGAGTCACCAAATAACGAGAAGATGATGTCCCAACTA
GACATCATTTGCCTCAGCTACACTCACATACACTTAAAAATAAAGACTCCTTTTGACTCT
CTCAGTGCACTGCATTCTCTCCTGTCTCCAGACCTGCACAGTAATTCTGTCCCTTCCCTG
GGGGAGGTTGAGTCCTCCTGGGGTCTCCTACAATGTAGCTTTTTAGGACATCCAGGGCTA
AACAGAGAAACGTTGTCTGGAAAAACCAAAAACAAAAAGAAAAAATGAATAAGCAATTGG
GTGGGTGGGTAGGTGGGGGACAGTTAGGTAGAGGGTTTTCTGGGTGGGTAGATGGGAAAG
TGGGTAACTGCATAGATGAGCAGATGAGTGGATGGCTGAGTGGGAAGATGCTCTAAAGGC
AGGGTGGATGATCACATACACTGTCCCCACTATTGATAGAAGCTGAGGGCACTCTAGCCT
ACCCCAGCCACACAGCATCTCCAAGTCTACCACTACCTTTCTTTCTTCAATTTTTAAGAC
AGATTTTTTTCCAGGGCTGGAGAGACCGCTCAGCGGTTAAGAGCACTGACTGCTCTTCCA
GAGGTCTTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTTTAATGGAAT
CTGATGCCCTCTTCTGGTGCGTCTTTAGACAGCGACAGTGTGTGTGTGTGTGTGTGTATG
TATGTATACATACACACACACACACACACATATCTATCTCCTAGCAAGCCCAGCATGCTT
GGGTCTGCAGTGACCCTGTGCATTCCTACAGTGCTTGCCAGAACAATTTTGAAGTGGTTT
GAGGCCTTGCCCTGCTCTCTCCAGAGCAAGGTTATCTAGAAATTTCAGACAATATGGCAG
ACACCTGCCACATGAATAAATTACAAGCCATCTAGGAAACCTAAGGTGTTAGAGCTAGAA
GAGACTTGATGGTACTTCAGAGACCATCAGGCTGTTTTGTGGAACTTCCACCGAAGAAAT
GCACAAATGGAGACTAAGAAATGAGACTCCAGGGTTAGAGAGATGGCTCAGTAGTTAAGA
GCACTGACTGCTCTTCCAGAGGTTCTGAGTTCAGTTCCCAGCAACCATGGTGGCTCACAA
TTATCTGTAATGGGGATCCAATGCCCTCTTCTGGTGTGTCTGAAGACAGCAATGGTGTAC
AGACATACGTGAAATAAATAAGTAAATAAATAGAAATGAGAATAAAGAAATAAATAAATC
CTTTAAAAAAAAGATAGGCTTTTTCTATGATCTCAGTTTCTCCTGGTGCTGGGATCAGAG
GTGTGTGTCACACACAACTCCTGGTGCCGTCTCCCACATGTGGTTGTTTGAACCAAAATA
GCTCCCACAGGCTTGCATGTTTGTCCATAGCCTGTGGAACTATTTGGGAAGGATCAGGAG
GTGTGCCTATCTGTCTACTGTCATGCGGACATGACATTCCTCATGATGGTCACAGACCCT
CTGAAATTGTAAGCCTCAAATAAACTCTTCCTTCTATAAATTGCCTTGGTCATGGTGTCT
CATCACAGCGATAGAAAAGTAACTAAGACACCATGTGACACTGAAGCCATCATAAACATT
ATTAATCAGACTATTGTATACAAGGGACATATGTGAAGCATCATAAGTATACAACATAAG
GGACGCCTTCATACATTATGAGAGGATATTGTCAATAATCTGTGTATCCATCAAAAGGGG
CCAGCTCTGTTCACTGGAGACCTCCACAGAAAAAAGCACTGTTTCCAAGTGTGGTGAGAC
ACACTACTCATCCCTGCCCTCAAGGGACTAAGGCAAGAGGACTGTAAGTTCAAGGGCAGC
CTGTGCTACATAATGAGTCCTCTTATTAAAAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved