Mus_musculus Locus Mono:215:SNORA32
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:215:SNORA32
Mus_musculus
Mono:215:SNORA32
X
SNORA32
1001..1108
2108
ATCCTGAGGGAAGTAACCCAATCACAAAAGAACAGACATGGTATGAACTCATTTATAAG
TGGATATTAGCCCAGAAGTTCAGAATACCCATGATACAATTCACAGACAACAAGAAGCTC
AAGAAAAAGGAAGACCACAGGGTGAATATTTCGGTCCTTCTTGGAAGGGGAATCAAAATA
CCCATGAAAGGAGTTATAGAGACAAAGTTTGGAGCACAAATCGAAGGAAAGGTCATCCAG
TGATTGTCCCACATGGGAATCCATCCCATATACAGTTACCAAACCCAGACACTATTGTGG
ATGCCAAAACGTGCTTGCTGACAGGAGTCTGATATAGCTGTCTTCTGAGAGGATCTGCCA
GTGCCTGACAAATACAGAAGTAGATGCTTACAGCCATCCACTGGTCTGAGCACAGGCTTC
CCAACGGAGGAGCTAGAGAAAGGAACCAAGGAGCTGAAGGGGTTTGCAGCCCCATAGGAG
AAATAATATGAACCAACCAGATCCACCCAGAGCTCCTCGGGTCTAAACCATCAACCAAAG
AGTACACAGGAGAAACTGAAGGCAGCTGCATATGTAGCAGAGGATGGCCTTGTTGGACAT
CAATGAGAGGAGAAGTCCTTGGTCTTGTGAAGGCTTGATTCCCCAGTATAGGGGAATGCC
AGGACAGGAAAGTGGGAGTGAGTAGGTTGGTGAGCAGGGGGAAGGGGGATGGAATAAGGG
GGGTGTGGAGGGGAAATGAGGAATGGGGATAAAATTTGAAATGTAAATAAAGAAAAAAAG
TTTTTAAAAATCAAAAAACAAAAACAAAACAACAAACAATCAAACAAATAAAAAAACAAA
GAGAAAAAGGAAAGCCAGAAGAGGACATTGGATTTCCTGGGGCTAGAGTTACAAACAGTT
GTGAGTTGCTATGTGAGTACTGGGATTCAAACCCAGGCTTTCTGGATGAGAGGATAGTAC
TCTTAAACACTGAACCATCACTCCAGCACTCCTGCATTATTTATTTATTTATTTGTAGAA
ATAAAAATTTCACATTTAACCATAAAGAAAAATTCCCATTAGGTTTTCCATATGCTACTT
CACTAGCAGTTAACCTGTTGGGAACATTTGTTCAAAATGGAAAAAAAAATAACATTGAAA
AACAGCTTGCACACACTGACAAAAGTTAATTTGTGTCTATTTTATTTTTATTTTTATTTT
TATTCATAATGTGGGTATATGTGTATGTGTGTGTATTTGTGTGTGTGTGTGTACATATGT
GTATAATTGTGCACATATGTGTACAGTGGGAGGTCTGAAGGTAAATTTCTGAGGGAGTCC
ATTCTTGTTTTCCAACATGTGGTTTCTGGGCATTGAAATTGAAATTACAAGAAGACTGTG
AATTAGAAGAAAGATGTAAAAATAAAAAACATAAATGGTCAAGACAGATGTGCTTAATTT
TAACATGCTGTCTCAGACAGTTTTAAAGGATTCTATAAACTAATGGTCTTACTCTGTTTA
GGTCAGGGACCCTTTTGAAAAAGTAATTAAAATTACAAGCTTCCTAAAAGATGAAGTGTA
TGTGCACACAAGATTTTACTACCAATTTGGTGCAGAGTATCCCAGACTCTATGAAAAATA
ATAATCATAATACAGCAGAAGGAAGCTTCTCATCCAAATATATATTTCCTTCATTTTTCA
CTTAGACAAAGGTTCTTCATTAGGAGAACTAAAACTAAAACAACAACAACAAAAAGACAA
AAACAAAACATACTTCATGAGATTAGCTTTCTGACGAAGAAATAAGAAATGCCTTCTAGG
TTTTATTAATAGTAAAGTTTTGTTGTCCTTTTTAAATTAGTCAGATCACTTTCTGTACTC
ACTGAAATATTTCTGATAATTCAGAATGCAATTTAGAAGAAAGCATATACTTCTTTACCT
ATCCCACTAGTTTAGAAATATGAAGAAGACTAGTCTGTTTTACATGGCTGCTGATCTTTA
TCTATTTTCATTTGGGTAGTGCTCTCTCTGTCTCTCCCTGTCTCTCTTTCTCTGTCTTTC
TGTCTCCCTATGTCTCTCTGTCTTTCTCTGTCTCTCTCTGTCTCTCTCTCTCTTTCTTTC
TCCTCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved