Mus_musculus Locus Poly:12:SNORD113
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:12:SNORD113
Mus_musculus
Poly:12:SNORD113
12
SNORD113, SNORD113, SNORD113, SNORD113, SNORD113, SNORD113
1001..1069, 1856..1930, 2575..2649, 3440..3514, 4050..4124, 7854..7925
8925
GTTCATGTTGTAAGTCATGATTGTCAAAGCAAATCCTTATAATATTGAAGACATGGAAT
CTATGATTCATCAAATATATATCATCAAATATATATGGAAATTGGAGGGTAATTAACATA
CATTTTAACATTGGTGATCTCTGAGTTCACCATATGAATAATTAAAGACTGGATGTGGCT
GACACAGAAAAGAACGAGATGAAGCAATTATATTATATCATTTAAGTACTGATTTGTGAA
TATGAGATAAACAGATATTGGAGGTCAAGGACATTGAGTACTTTACTGACAAGTTATAGA
TACAGCCCAACACATACAGGCTATAGTTTGTGAATCTTTGGTTCATGGACATGTGTTTAC
ATAAAGTTATCACAGGAAATTGAGTTGTTTGAATTGAAGTTAGGTGGCTAAAATGAGGTT
CCAAAGGTAAATAAGAATGGTAGCAAATGCTAGAGAAGTCACTTGATAGTAATACTCCTC
AAAATAAAGTTAGTGCAGAACGTCTGGCTGGAATGGGGTATCCTAGATGACTTGATAATC
TCCTTGTATTGGAGGGAACGTAACCCCACGCCCTTAGAGAGAAAGCCAGGTTTTCCTTTC
AAATGTAGGAATCGTGGGACAATCTTGAGAGCAAGTCTTTAGATTTTTACTTCTTTCTCT
GCCTTCTACCATCCATGGAGAAGACCCAAGTGATCTCAAAGGTTTGCAGTGACGGACAGT
TCCTGGGATGCCATAGCAACAATTCAGAGCTCATGGTGACTTGACATCTTCGGCTTTGAT
CCTTCGGTTGGAACCTGCTGATAGGTACAGAGAATCTATTCTAAACACCAAAATCTGGGT
GCTTAGGCAGAGTATGTCGAAAAAGAAATAATCTAGTTAGCTCAAGGACTAGGCAGTGAG
GTGCCCCAGCACAGGATAGTCTCCTACCATGTAGTCTTCCGAGTGTACCCAGTAGCCAAG
GACTGAGCCATTCCTGAAGCCTCAAGAGAGGAGCCTAGCTCAGGACCGATGATGAGATCT
GATGGTGTCTGAGTGTTTCTCGATGACATGAACAGATATCTGAGGTCAGGCAAAGAACAT
CTACAACTGGGCTGCCTTTTGGTGTTTGCCCATGGCCTAAGACACACAACATACTTTTCA
ACACTGCTCTGACTGCAACTTATTTCCATTAGGCCAGGAAACGTGGCTGGCAGATAGGCA
AACTTGGAGCAGAAGGGGTGCCCCCATGCCTGTGCCTACAGGCAGAGCAGCACAGCTTAA
ATACTCCATGGGGTATGTGGAGCGATGGCCGATAATTTTCTGGCTCCATGAATGATGACT
TAGTATAGACAGAGGCCAGCTTATTTTTCTTGGGAAATGGCAAGAAATTACTCTCTCTTG
GGAAGAGAAAATACAATTATAGCCTAGGCAAAACTTATGAGCCTAGGTTCTGTAACTGTG
GAGGGCACGGAATGGTATCCCACAGAGTCTCAAAGATATCTCTCCTTTCTCTCCCCTGTT
CTCTTCAGAAAAGCTGACTTAACTGATGGCACAAGTGTACTCTGAACCAGAACCCACTTC
GGTCTTCACCGTGACAGCCTGAGCCCTGCTGACTGAGAGGCGGCATTTTGATCTTCCTCA
CTTAAGGTATGAGCTTGTAGGTATGTGTAGTGGTGAGAGTGTTTCTGCCTTAGTGCAGTA
GCAGAAGACTCTTAGGCCATTAGTACAATAGTTGGTTGTAATTTTTGGCTTCTAGTGGCT
GCTCTTCAGGGGCTGCCACACAGAATGTTCTAATACCCTGTGATCAGAGCTCTGCCCTCA
GCACCCACTAAGCAATTAAGGTGTGCAGTTGGCTAGGGAGAGAGGGGGCCCCATCCAGGA
CCAATGATGAGATCTGGTGGCGTTTGAGTGATACTCCATGAACGCCAAGTATCCAGAAAT
CTGAGGTCAATCCCGATGCCTTGCTAAGAGCTAAGCTCTGGATGGAGGCCCATAGGTCTA
CGCCCGTCCCTTGTGGACCTGTGCTTCGAGGCAAGGGCTTGAGTGCTCTTTGATCATGTT
CCTCAGAATCAAGGCTGGGGCAGCTTGAGGTCTGTCCATGGAACTGGGTCAGAGGGGCCC
TGAAAATCTACTTGGATGAGCTGGAATTCCACAACCACTCCCTTAGAGATAAAGCTGACA
AGACAGTGCCCTTGAAATGTAGGAATCCTGGGTCAAACTTGGGAGCATGTCTCAATAGTT
CTATTTTTTCTCTACCTTCCAACATCCAGAGAGCTGACCCAAGTGATATGAGAAGTTTGC
TGTGATGGACAGTTTCTGGGTGCTTTGCCAACAATCCAGAGTACATGGTGACATGTCAAC
TCCAGCTGTGATCCTCCTGTGTGGCACTGACTTACAGGTATGGAGGGTCTCTTCATAAAA
TGGGTGTCAGGCAGACTATGGAGAGAAAGTGTTAATTTCATGCTAGCTTGCGGACCAGGC
AGTGTCAAGCCCCCCCACAGCACAGGATAGCCTCCTACAGTGTGGTCTCTTGAGTGTACC
ACAGTAGCCAAGGAATGAGCCATTCCTGAAGCCTCAAGAGAGAGGAGCCCAACCCAGGAC
CTATGATGAGATCTGGTGGCATCTGACTGTATCTCGATGACAGCCATGAGAACAGATGTC
TGAGGTCAGGCACAGAGCAACTTCAGCTGTGTGCCTTGTGGTGCTAACTAATAGCCTGAG
ATCGAGGAAAGCGGGATCATTTGTGTCACCTTTGCTCCTTAAACTGATCAGTTTCCATTA
GGCAAGGACTTCCAGAGAAGCAACGTCGGGTTATAGTTGGTAGGACCATGACCTAGGGCT
TGGTGGGGAGCAGCATGGCTTGGGAGATCTAAGAGGCATGTTGATAGATTGGGGAGATGA
TAGGCTGACCCCATGGAGGACTCCTTAGCCTCTTCTTGGTCCAATCCTTTTTTCTGGCCC
CTGGTGAGAAATTAGTCTCTCCTGGGAAAAAAGTTTCAGTGCAAAGTAGGCCCAGCTCAT
GACCATTGGCTCCGTAAATGGGGAGGACATGGGGTGGTGGCCCACAGAGTCTCAACACTG
ACTCTCTCCTCTCTGCCCTGTACCCTGCAGAAATGGCGACCCAACAGATGGTACCAGCAT
GCTGAGATATAGAACCACCCTTGTATCACCACTGTGACATCTCAGAGCTTTGCCGACCAA
GAGGCAACATCTTGATCTTCCTTGCCCACCAGCTTGCAGGTACGTTTAGTGGCAGGAAAC
TGTGTCTTCCTTACAGCAGTACCAGGAGAGAGTTAGCGCATTAGTGCAATAGTTAGTCCT
GATTTCTGGGTTTTTCTAATGGCTGCTCTTCAGGGGCTGCCACACAGAATGTTCTAGTAC
CCTGTGATCAGAGCTCTGCCCTCAGCACCCACTAAGCAATTAAGGTGTGCAGTTGGCTAG
GGAGAGAGGGAGCCCCATCCAGGACCGATGATGAGATCTGGTGGCGTTTGAGTGATACTC
CATGAACGCCAAGTATCCAGAAATCTGATGCCTTGCTAAGAGCTAAGCTCTGGATGGAGG
CCCATAGGTCTATGCCCGTCCCTTGTGGACCTGTGGTGTGAGGTGAGGGCTTGATTGCTC
TTTGATCATGTAGCTTGAAATATTCCCATGGAATTTCGTCAGAGGAGCCTTAAGGCCACA
CCCACTTTTTTTTTTTTTTTTTTTTTGAGAGAAAGCCTACAAGATAGCATGCTTGAAATG
CAGCAATTTTGGGACAATGTAGGGACAGCGTCTCAATTTTCCTTTCCTTTTTCTGCCTTC
TTCCCTCCAGGAAGGTGACTCTAGTGATGGTAGAGTTATGGATAATGGACAATTCCTGGG
ATGCCATGGCAACAGTCCACAGCCCATGGTGACTTGTCAACTCCAGCTCTGTTCCTTCTG
TGCGCACCTGCTTATAGGTATGGAGATTTAATCAAAGCATCGGTGATCAAGCAGATATGG
GTAGAAAGTGTTAACTTAGTGCTAGCTTGTGGATCACACAGTGTGATGCCACACTTACCA
AGAATGAGTCAATTCTGAGAGAGGGGAACCCAGAACAATGATGAGATCTGGTGGCATCTG
AATTTTTCTTGATGGCATCCATGTCAAGAGAAATCTGAAGTCAGGTACAGAGCCACTTGA
GCTGAACTGCCCTCCATTGTAAGTTCCATTAGCAAGGAAACATGGCTGACAGGTAGTCGA
AGTTGGTTTAAATTGTGCAGAACCACAACCTTGCATGGGGACCTCACAAAGGGCATGTTG
AGAAATAGGTGTACTGAGATGCTGACCCTAAGCAGCATGCCAGAGCATAGAGGGGACCCA
GCTCTTTTTTCCTTCAAGTGGAAAGAAATTAGTCTTTTCTGGGAAGAAAATGTACAGGTA
CAGCTCAGGCAAAGCCCATCAGCCTGAGTGACGTCACCGTGGAGAACATGGCATGGTGAC
CCACAGTCTCAACACTCTCTGTCCCTTTTCTCCCCTGTTTTCCTCAGAAAGGCTGACCTG
GTGATGGTGAACCACCACCCCAAGTCTGCATGTCACAAATCAGCATCTCTCTCTCCTATG
GAGTCTGGTTCTAGGTCTTGACAGGTATTCGTTATCAAATCAGTCAAGTGAACTATCATT
GATAAGATTCATTAAGTTCATTAAAAGGGGGCAGTACACCCAGTTTCATAGAGTGAATCT
CTGCTTGTGTGTCCTGTGAATTGTCTTTTTTTTTTTTTTAATGGCTTACTAACAGGTCTT
TCTCATTTTCCACAGAGGCTGATTGACTGATGTCATTGCAAAAGTTTCCTGTCATAGAGA
GTTCCTCTGATGTCCCTTCAGCACCACTACAACTGGTATTCACTTTAGTTTCACATTTCG
GGCAGATCATGGTAAAACCCCATGGTCATATCACATAGTTCTTGTGCACGTGGCATGTGT
AAGATCAATCATACAGCAATAGCTTTTAACTTCAAAATTGAAACCAAGCACAGTCCAGCT
GCCACAGAGGTTTTCAATTTCTTTTCTATTTCGTATTAACCTTATAGTCTCCATTTTTTC
CTCAGAAAATTTATGTTATATATGTTAAAATCATTTTTAGCATATCACAACCTATGCATA
TTAGAGTTTGTTTCCATATTGTGATTCATATTTATAATTGTTAGGTTCTTCTAAACTTGA
AGCCACAATCACATATTACTGTACTTGGCTTGGATTGTCCATGATAATGACATTGAGAAA
GTCTGTCACGTGTCCAGGGTCGTGTGCCACTCACTAATCTTTTACAGCATACATTCTATG
AGTAGTGAGTGACCCTCAAACATTAAAACAGAAACTTCATATGAGTCAACACAGCTGCCC
CTGGGAAAAGGTGGAAGGAAAATAATATGGTTGACCACCACATTAGTTATAAGTCCCTAC
CACCCTGTCCTGAGTCGGGTCTGTGTGGAGCAACTCCTTACTCTTTATTCTTTTATTAAT
GATAATGCAAACATTACATCCTATAGCCGAAGTTTACGTTCTGGAGTACATAAGGAATCA
TTCATATTATTTAGTCATGAGTTAGATATATGGCTCTGTAAGTCAAAGCTGAAAGCTGTT
GCTCTTTTATCTGCTTTTAAAAGTCATTTAACAAATGCTTTGTTTTGTTTTGTTTGTTGT
TCCCCACATCGCGCCTCTGAGAGCTGACTGCAGGATTTCCTATGTTTAATGACTGCCTCA
AGGTAAACATGGGTAAAAGCCATACATTTTGTCGATGTTTTGGTTATTATGGCTGTAACT
TTACAAAGCATGAAATAGAATCCTACAGGTCTACTCTTACTTTGTCTTTTGGGGTGAAGA
TGGGCTTGTGTCCTGAGTAAATACGATGTCTGAAGATGGTTCATAGCACTTTCTTCATAG
CGCTGTGAATACTACAGTCTGAATATATCAGAGAGCTGTGCTCCTGTTGAATATTTGTGT
ATCACCAGCATTGCTAGTGAATTATTGGCTTAGCCAGTAAATAGTATCTATGAGAACGAG
GAAAGGTCAAGCCATTTCTGGACCAATGATGATAGTTACCAAGGTATGAGAGAGATGACG
AATAACACTTGTCTGAAGCTCAGAGGTCCAACCCAAAAGATAGGTAGATAATCAAAGGTC
CTTGAAGGACAATGGCATTTTTTTTTTCTTTTGTGCTCTGTTTTGTACTCCTCAGAATGT
GTGCTCCTAGGCTGATGTCTGCATTTTCTATGATCAGCAGTGGAACATTTGCACCTCTGC
ATTGAACATGGGGCAGTGTGAGTACTAGTTACTTACTATCCCTGCTTTTTATGCAGTCTG
TTGAAATTTGGTTACTTCATTATTTAAAAATATCTAAGAGAGCTGGTAAGGTAGAGAGAG
AGAGAACAGATTCCTAGATATTAAGCCCTTGTCTCCATGCACATGCCCTTGGCATGCATG
TTCATAAACACAAGTGAATATATTCATTGAAAATAAGTTTTAACTATGGTTGTATTAATT
CAGCCAAATACAACCAGTGATGCCTATGGATTTTAGTTGAAATAGGACAATGAGTTGGCT
ATGTTTGATGCTCTTCGGCTCCTCATTGAAGGAGAGAGACACTTGGAGGTAAACTGGATC
TTTAGAGGAGTGTCTTTCAGTGTGTTTCAGTACTGGGAGGAATAAATAGACTTTTCATTT
TTATTAGTGAATTAATGATTCAATCTAAACATAAAAGTGAATAGAGCCAGGGTGGATTCA
TGTTGAGCGCAGGTAGTATGAGTCCAGGGTGCTGTGCATGTGCCTGCCTCTGGGTCTCTC
CTTCAGCAGATCTTCCCTCTGGTTTCACCAAAAACATACTACTATTTTAATTTCTTGAAT
AGTAAATAAATATAGAAAACAATGAAGAGAAATGAATGAAAGTCTATTCACTAATGAACA
TGAGTATCAAGGCAAAAAAAATTACCTTATTACACTGAAAATATGAAATCCAAAGAGAAG
CGAGTAAGTAGCATTCAACTCTTTCTGTCTGTGGAGGAAATGGTATCAGTAACAGATACT
ATTTCATTGCTTTGCAAGAAGTTTGAAGACTTTCATTTTTAGAAGACAATAGTATGAATA
TTTTTAAGTTATGATAGCTTGCACGAGTGGCTCAGATGACAAAAAAAATAATCAAAGAGA
AAGCAAGAAAACTTTTTTAAAGCAAAATTTTGTTTGTATGCTTTCCTGAAAGTTGATGCT
CTTGTGTACTGACATGTTTATTCATCCGTGTAGATCCTGGGACAGTTGTAGTGCTCTCTA
AGTAGTTCATTCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCTCC
TCTCCTCTCCTCTCCTCTCCTCTCCTCTCCTCCCCTCCCCTCCCCTCCCCTCCCCTCCCC
TCCCCTTCCCTTCTCCTCCCCTCCCCTTCCCTTCTCCTCCCCTCCCCTCCCCTTTTATTC
TCTCTGTACTCAAGGTGGACCATCTAATTAGAGGACCCTCCAATGGTCAAGCACTCTATT
TGCACCAGCTTGAGGAGACGAACAAGACCAGTGTGAGTTGCAGGATTATCCTTGTCTTGG
TTTGAGTGTTTTAAGACAGTGTTGAAACAGTGTATAGTGTAGTCAGTAATGACCATTTGA
ATACCACTGGTTGCTAGGGGGACCACATATAGTTGTCCATTTGTCATTCAACAGTGTGAA
CCTGTGTGCATCGATACATGATGGACATATTATAGAAATTCCATGCACAGATTAGGAATT
ACTAGAGTCATATTTATTTATTTTGTGGGGTTGGTAGTTTCTAAGCATAGGGTTTATGAT
AATTAAGTAATTAATAGCGATAGTGTAAATAATTTAAGAAAAGGAGAACTAATCTTGGTT
GATGATGACCACCGGTGGCATTTGACTCATACATGATGACTTTGAGTCTGAAACACCAAG
ATCCAACAGAGAAGATAAGTGGATACATGACAGTTGATAGCAAAGGTGTCATTGTTTTGT
CCTGTTCTCTCCTCTGTCTTCCTTAGAATGGACTTTCCCAAGGTATCTATTCACCTCCAA
TGGCTTCCAGCCCTTCAGTTGCTCGTGATGATGTGAGATCTGCCCAAACTTCTCCTCATA
GTTTTGATGGTTTGATGAAGGTTAGTCCCTGTGATATTATGAGGTGAAATATATTCACAC
TAGGTTAAGTGTAATAGTATAACATAGTATATTATATTATGCTTATGTCTCAAAAGGAGG
ATGGTTATTGAAGGACACGCATTTATCTTCACAATATAGAAATGAGTGGAGAAAAACAGG
GCCAGTCTTAGATTTATGATGGCCATTGGTGGTACATATGAGGTACAAATAGAGTCTAAG
TCTCTGAGGCCCATTATAATGTCCAGGTGTCAACAATAGAGGGGAGTTGACTCTGGTCCA
TATATATATATATGGTTGGATGGGTGCAAGAATCAATAAAGTATGGTCCAATTACAAAAT
ATATGATGAACAAAAATACTTTTTTAGGTCAAATAGGATTATACATATCTCCTTTTCAGC
CAATGATGAAAGCTCTAACATAAAGCATAGCTATTTGAGTATCTGAATCATTGCTAAGCT
CTCCATTATTTACTGAAGAGCTAATTAAATAGATACTCTCTCTAAATAAAGGATTACCTA
GAACTAAGTAAGTGAAGATCATTGTCAGAGGTCAATAGCAATATATTAATTTTGCCTTTA
TGGTTTCTGCTTTGTATTCCTTAGGTGTTTGCTGCCTGGAGGAGGTCTCCATGTCTAGGA
TCTCCGCTGATGTCATGGGTGGTGCTGGGCTGACCAGTGTGAGTAGTGCCTTGGACTCTT
TCTCCACGTTTGGTGGTTTGCTTAGCAGAACTCAGTGTGTCACTGAGAACTGTAACATGG
CATTTAGAATGAGTGTTTCATACCAGGGAGTGCCACAGACATGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved