Mus_musculus Locus Poly:5:SNORD116
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:5:SNORD116
Mus_musculus
Poly:5:SNORD116
7
SNORD116, SNORD116
1001..1094, 3525..3618
4618
TGGAATTCTGAACTCTCAGAGGAGTTTGATTTTACCTCATGCAAAGACCCGGAATTAAT
GATCAGAGAAGGACTGGAGCCATGATTGAAGGCTCAAAAGTTGTTGGCTTAGATATCTTT
GGAGACCCAATTTTGCTGGTGGACTTATTCAGAGCTGCCTCCTCCTTCTTCATCAGCATA
GCCAAGAGGACCTATGATTGCGCTTGTTATTGGATTTTTCTGACTGGATGCTTGGAGAAG
AGCCTTCATTCCCTTGAAAACTTTGCTCAGGACACTGGTGGAGGAAGTTGATGGCATGGA
CCTAAGAGAAAGTGTTGAGTACCTGTATTGCAGCTCACATATCATCCTTAAGTCCTTAGA
GTGAGCTGAGGACCCAGCAAGCACTTGAGAGCAAAGGGCATGGCATGTTCACATCCAAGG
CCCGAGAGTAACAGCAAGTGAGATCTGGAAGGGCAGTGTGAAGGGGTTGGTAAGAGCAGG
AGTGTAGAGGGTGCCTGTGAGATATGACAAGCCCATAGTACATGGTAAGCCCATAATCCA
TGCGGATTTTCATTGGTCCCACTGTAATCGGGGCATGATCTCTGTGCTGTCTTCACAGGG
TTGCATTCCCTTTCCAGTATGGTCCATGGAAAACATGCAGAGGAAATGGCCCCACAGCAT
TGGCTGAGTGTTTATGTCGTCCAACCGAGTCTCCATCGAACTGTTGTGGTGTTGCTGACT
TGCCCTAGGTCACCTGAGTTAAAAGGTAAGGAACATGGGAATTGCTGCATGAATTCTAGG
TGCTCAGGTCTTGGTGGAGCAGGGAACGGCTGCCATTGAATGTGTCCAGGCCCTTCGGGA
CATGGAGCATGCCTAGGGCCTCTGGTTTCTCCCATGTTTGGAGCTTCGGCCCATTGTTCC
CTGGCAGTGGATTGTCAGTCTCCAGCAGTCCATTGCTCTACCCAAAGCCAGAACACTCCA
GAGTACTGGAACCACTTGATGCAATGCACTCCAACGTGCTTGGATCTATGATGATTCCCA
GTCAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACTCTGTACCGCCACTCTCA
TCGGAACTGAGGTCCAGCATCTTGGGTCTCCCAGGTGCTATGGGCGTCAGGCACAGGCTG
CCCAACCACTCCATTTTTCTTGACTTCTTCGGGCTCTAGCCAGACTCTCCAGAGACAGGT
GTGTGCTTGGCCTACCCTGCCAAAAATCCATGGCATAGGACACAGCAGGTCCTTAAGCTA
TGGTGGCTTGCTCCCTTTGCTGTAGTGGAGATGCTTGGCAGATACTCAGTAGGTAGTCTT
GCTAGGTCCAAGGAGAGGGCCCCAGACATTGTGGAAAGTAGAGTGTGAGGCAAAATTGCA
GTGGCAGTGGCACCAAATCTTGGCTTTTCACATGGGAATATCAAGCAGTGGACTCAGGCT
TCTCAGAAGCACTTATATGAATTTTAACCCTGTTGCATTGCTTTATGGAGTTAATAGAAT
GCAGGCTGCTGGTAGAGTGTAGCTTGACCCAGTAGCATGTAAACGGGACTGTGTGACTGT
TGTCTGTTCAGGTGGTGAACAGAAGGCTCTGTGTCCCTGGCACCATGGAAGTTTCCCGGG
TGATTGGCTTGGAAATATAGAAGGAGCTAAGCCTTGGAGGTGATGACAGTCACCTCACGG
GTCAGTTTTCACCACATTTACACACTTACCTGTGTCTGCAGACAGTGAAACTTTGATGGA
CAAGCTGGGTGCATGAGACTTGCAGACCTGTGTCTCGATAGATTTGTTGAAATAACTTTT
GTAGGAATCTCCCCTTTGGTAGGTGCTGTTGCTTTGGATGTTGTTGAAGGGATATCCTTG
GTATATTTGGATATTGTTGTCAGCCTCCTTGGCAAGGTAAAAGGGAAAGTCTAGGAACAG
TTCTTGCACCCACAGCCTTAAGAGAACCATCTTGGTGAGGGACCCTCTAAATTAGAGACC
AAGGTGTCATGGGACCTTTCTTTTCGATGTTTTGGCCTAACTCTTATGGAAAGACAAGTT
GCTAGTGTGCATAGGAAGGAGGTTTCAACAGGGCACATGGTGTTTTGCAAATCCACCTTG
AGAGCCATGCTCATTAGAATCATCAGGGAGAAAATAAGTTCTTGAATGCAGACTGCATTT
GACACACTAAGATAACTTGAGTCAAGTTGGATCCTGGCCTGTGATAGTTCTGCAAAATGG
GATTTTCATTAGTGTGAGAAGGTGAACAGTATAGTCTGAGAAGTTTTGACCAGAAGAGAT
CAAAGCAGGGATGGATGGCAAAAAGCAATCTCATGACAAGGTGGAAGTCTTCACAACAGA
CAAAATGAGCACTGGACAGGTGGACATAAATAGGGATGGCTGCCACAGCAAGGAATGTCT
CAGGGTAAAAGACACACACTCACACCACACACACACACACACACACACACACACACTAAC
ACAGAGAGAAAGAGAGAGAGGGGGGGTTCCTTTAAGCTGTGAAAATGAAGCCTGCTTCCC
ATGAGCTGGAATTTTGAACCCTCAGAGGAGTTTGATTTTACCTCATGCAAAGACCCAGAA
GTAATGATCAGAGAAGGACTGGAGCCATGATTGAAGGCTCAAAAGTTGTTGGCTTAGATA
TCCATGGAGGCCCAATTTTGCTGGAGGGCTTATTCAGAGCTGCCTCCTCCTTCTTCGTCA
GCATAGGCAAGGGGACCTATGATTGCCCTTGGTATAGGCTTCTTCTGACTGGATGCTTGG
AGAAGAGCCTTCATTCCTTTGAAAACTTTGCTCAGGACACTGGTGGAGGAAGTTGATGGC
ATGGACCTAAGAGAAAGTGTTGAGTACCTGTATTGCAGCTCACATATCATCCTTAAGTCC
TTAGAGTGAGCTGAGGACCCAGCAAGCACTTGAGAGCAAAGGGCATGGCATGTTCACATC
CAAGGCCTGGGAGTAACAGCAAGTGAGATCTGGAAGGGCAGTGTGAAGAGGTTGGTAAGA
GCAGTTGTGTTGAGGGTGCCTGTGAGATATGACAAGCCCATAGTACATGGTAAGCCCATA
ATCCATGTGGTTTTGCATTGGTCCCACTGTAATCGGGGCATTTTTTCCGTGCTGTCTTCA
CAGGGTTGCATTCCCTTTCCAGCATGGTCCATGGAAAACATGCAGAGGAAATGGCCTCAC
AGCATTGGCTGAGTGTTTATGTCGTCCAACCGAGTCTCCATCGAACTTTTCTGGTGTTGC
TGACTTGCCCTAGGTCACCTGAGTTAAAAGGTAAGGAACATGGGAATTGCTGCATGAATT
CTAGGTGCCCAGGTCTTGGTGGAGCAGGGAACGGCTGCCATTGATATGTACAGGCCCTTC
GGGACCTGGAACATGCCTGGGGCCTCATATTTCTCCCAGGTTTGGAGCTTCGGCCCATTG
TTCCCTGGCAGTGGATTGTCAGTGTCCAGCAGTCCATTGCTCTACCCAAAGCCAGAGCAC
TCCAGAGTACTGGAACCACTTGATGCAATGCACTGCAACGTGCTTGGATCTATGATGATT
CCCAGTCAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACTCTGTACCGCCACT
GTCATTGGAACTGAGGTCCAGCATCTTGGGTCTCCCAGGTGCTATGGGCGTCAGGCACAG
GCTGCCCAATGTTGGGAGCCGCGCCCACATTCGCCGTTACAAGATGGCGCTGACAGCTGT
GTTCTAAGTGGTAAACAAATAATCTGCGCATGTGCCGAGGGTGGTTCTTCACTCCATGTG
CTCTGCCTTCCCCGTGACGTCAACTCGGCCGATGGGCTGCAGCCAATCAGGGAGTGACAC
GTCCGAGGCGAAGGATAATTCTCCTAAAAAAGGGACGGGGTTTCGTTTTCTCTCTCTCTT
GCTTCTTACGCTCTTGCTTCTTGCACTCTGGCTCCTGAAGATGTAAGCAATAAAGCTTTG
CCGCAGAAGATTCTGGTCTGTGGTGTTCTTCCTGGCCGGTTGTGAGAACGCGTCTAATAA
CAATTGGTGCCGAATTCCGGGACGAGAAAAAAACTCGGGACTGGCGCAAGGAAGATCCCT
CATTCCAGAACCAGAACTGCGGGTCGCGGTAATAAAGGTTCCCGTAAAACAGACTGTTAA
GAAGGATTCAACTGTATGAATTCAGAACTTTTCAGCTGGGGAACGAGAGTACCAGTGAGT
ACAGCTTTACGAGGTAAGTCTGATCTTGAACTTTCTAAGGAAATTCAAGACAGTCTATCA
GAAGTAAAGTGGAATATGTTTGGCCTTGAATTTTTTCTAATGTTAGGAGCCCTTTTGTTC
CTTTTCACATGTTATCAAGTGGTTAAGATAGGGCGGATTCTAGATGAAATTCAGGACAAG
CTATCAGAAGTAAAGCGGGGAGAGAGAGTAGGAGCAAAGAGAAAATATGGTACACAAAAT
AAGTATACAGGCCTTTCCAAGGGTCTTGAACCCGAGGAAAAGTTAAGGTTAGGTAGGAAT
ACCTGGAGAGAGATTAGAAGAAAAAGAGGAAAAAGGGAAAAGAAGAAAGATCAATTAGCG
GAGGTCTCTAGGAGATACTCGTCACTAGATGAGCTCAGGAAGCCAGCTCTTAGTAGTTC
  Untranslated Region
  Coding Sequence
  snoRNA
NC_000073
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved