Mus_musculus Locus Mono:430:snoR38
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:430:snoR38
Mus_musculus
Mono:430:snoR38
11
snR38-4
1001..1076
2076
GCAGTCTTTCCTAGCACCATTCTTCAGGATCAGGTATACCAAAGTCAGGGGTTTCCCCC
CCACCAGAGAAAAAGGATCTTAAAAGCCCTTATGCTATGTAACTGAACAGCCTCGGGATA
TTTGACTAGAGACAAGATTCTAAGGTCTGTGCTACCTGCCTTGAATCCAATGAGTGACCG
CCTCCTCAGGGAAAGATTTGTTAGGTGTCTTCTGCCAACACGTGTTGAATTTCTAGGAGG
TACAAGGAGCAGAGATGTCTTCCTTGTATTGAATTTAAATAGAACAGTTCATGCCACCTA
AATCAGGAAAACAAATACCCTGCAAAGGTAGCAAGGCCTGTCCCTCCCGGGTACATCAGC
AGATAGAGGGACAGTGTGGCCAACAGAAGCTCTGGGTGAGGATTAAATTAGATTACTTCG
GGTGTTCTTCTGAGAGCCTCTTCAGGACCTCTGATGAAATCCTTTGTGATTCTGACATTT
TGAAGTAAGTCTGTAAGACACAGCTCTTAAAAATCTTCTAGCTTGGTAGTCTTCTAACTG
AAAAGGCTAAAAAACACAACCCTCCAGTCCCCGGGGTTATGTATGGTGGCCTCATTTTAA
GGTCAACTACTTCATTATTCTGTCTGTGTAGAATGCCAAGGACATTGCGTCTGGTTCTAA
GCTATTTTTTTCAGAATAAATATAATAAAATGTTTTCTTCTCAAATGAAATGACATGCCT
TCCAGGGCCACAGAGCCAGGTTCTGTAATATTTTTCTAACTGTGTTTGGAGTAAATTCAC
TACAAGTTTAAAATTCAAGATAGGCTAACCAGTGCCAACTGCTTCAAAATTGTGCACTGT
TCTAACCTCTGAGATTTAAACAAAATCACCCCCATTACATAGGTTAGAGAAGTCAAATAT
CTTGGTAGATGTCCCTTAGCTGGTAGAGTGATATAGCTATGCCAGTCACATATCTGAGTG
AGCCACAGATTCCTAATTAAAGGGAAGAGTAAGAGTTGACTGACAGCTGAGGATGATTTA
AGTTATCCCTGTCTGAAATGACACTTTTGTGAAGAGTCATGGTTTACTGAGGCTCGACGT
TTTGAGGCCTGTTTTGAGAATGACCACGGTAAGGTTGCTTCTGTTAGAATGAAGTGGGAT
ATCTTTATTACTCCTTCAGACGGAGGTGTTGTCTCCAGGAAGCATCATCGAAAGGCGTGG
TGCACAAGGACCTTCAGGATGCCTGTGCCTGGTGTCGGCTGCGCCTCAGTTTCTGGACCT
GACTCAGAAGGATGCCTGTGAGCAGAAGAGCTGGCACGCGCAGCTCAGTGGAGCATCAGT
GCCAATCAGTCCTGTACCCTGGCTGAGGGGTGTGCTAAGTGGCAGATTCCCAGTTGGCTC
ATCGTAAGGCGTGGCACAAAATCACCATCAAAAGGGCCTTCGAGATGCCTCTGTCTGGTT
CTTTCCATGTTTCTAGGTTATTGCCCTGTAGTTCCAGAGAGAACCACATAGCCTGCTGCT
GCTCCTGCCTTTAATTTCCCAGAGTCATCAGACAACCTTGGAGTTTGTTCTGCAAGAGGA
GCCAGTAAGGCCTCGTGACTGTGGTCATCCTCATGACTGTGGTCACCCTCGGAAGCCTTT
GACAGCTAGCTGGTGAGGGTGCTCAGTCGGAGGCCCTGTGGAGGCCCCTGCTAAGCCGAG
AAAAGCATTTCTCACAGTGGATTTCCTGGAAGTCAGGGTTGGCCTTTGTATTTTGAAGCA
CAAATAAACTTTATAAAATTAAAAAAAAAAAAGAGGTTGACTGACTTTGTGATCTGCCTG
ATCTATAAGGCAATGACGGCCATGCCTTTGGCTGGAGATAAGAACTTCAGTCACATTAAC
TTGGCAAAACCTCAAGAACCAGGTAACCAACCAACTAACACAACACAATAATGCCTGACA
CCTTGAGAAAGGAGCCCCTCAGAAGGATTTACACAGATCCTGATAGGGCTGGGGAGATGG
CAAGGTCAATAAAGTGCTTGTCTTGAATGTGTGATAACCCTCTCAAAGATCTGGGCATGG
TAGCATGTCCCTGCAATTCCAAAGATGGCAGTTTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved