Mus_musculus Locus Mono:71:SNORD93
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:71:SNORD93
Mus_musculus
Mono:71:SNORD93
5
SNORD93
1001..1071
2071
ATGATTTAGGAATCGTGATTTGGAATTCCTAAGACCGGGTATAGGTGTTTAGCGAGCAC
CCAGGAGTCCTCCCTGTTTAAGAGGTGACTGATTGAGACACCAATTAAAAGTAAATATCA
TGGTTGGAGAGATGACTCAGTGGTTAAGAGTACTGACAGCTCTTCTAGAGTTCCCGAGTT
AAATTCTCAGCAACCACATGGTGGCTCACAACCATCTGTAATGAGATCTGATGCCCTCCT
CTGGTGTTGTCTGGAGATAGCAACAGTGCACTCATATAGAAGAAATAAATCTTTTTAAAA
GATTATTAGATTATTGAGACAGATTGTCATACTGGCCCAGAGAATATTTGTGCTCTAGGA
CCCTAAGTATTGGCATTTATGGACATAAGCCACTGTGCCTGGTAAAGGACATTTTAGAGG
AAAAATAGGCTTGTGGGCTCTTGTAAACAAGTTCCCTGTGTTGTAGTTTTCTTTCCGTTA
GAGGTTAGGGTTCTGTTGAGCCCCTTCGAGAGTGAAGGGCAGCATGAGCCACCTTCTAAG
GTAAGGAGTTATTTTTCCCTTCCTCATTCAGGCTCAGGAGACACATCTGACGCTGCTTCT
GGTTTTGAAATCAGAGAAAATGTTTCACTTTCTTAAAGGAAGAGTACTGCTATTACCTGC
AGTACTATTTGCTTCTAAACATTAAGAGTTTTTGCTTCTGGGGTGGAAATAGTGGGAAAG
ATGGCCCAGAGGGAATAAAATGGACTCCCAGCTGTCAGCAGTATGAAGATTAGAGCTCTG
TGCAGGAATAAATGCTAGTCAGAGGCAGGCCTTCCATCACCAGATGCAGCTAGGAGCCAC
CAGGAAGGTCCTTTCTGAAGGAAGCTGTGGCTGCTGCTTGTAACAGTGCTGGTTCTTTTT
TCTTTTGAGCAGATGAGTGCTGTGTCCAGGATGATCATGAATTCAAGGTATGTGTTAGAT
GGCAAGTTTGGCTTTCCAGGCATAATTCCAGGAACAGTTCTTGGCCAAGGATGAGAACTC
TAACCTGACTGGATACGCTGCTGTGATGGGTTAAAGGATTTACCTGAGGCCAATAGAACA
GGCAGGAATTTAATGCAGTCACCCCATGTCTTTTTAAAGTAGATGAGGGGTTGGAGAATG
GAGTGAGAGGGCTTAGCAGTGCCAAGCCCGTTACCTTTGATTCTGGGACCTGGTGGAGAG
AGCCAGCTCTCTAGAGTTATTCTTGCACCTTCATGTGTGTGCTAGCACACGTGTGTGCAC
ACTCAAAATAATAAATGTAATAAATGGGAGCGTTGGTGAATGTTTAATACTTAGAGGGTG
ATATGGCTTTGCATTTCAAGTTGTGTTCAAACATTTCTGAGTAGATCCACCCAATGTACT
GGGTAGTACATTAAGTGTTCTATTTATACTAAAAGATGGTTAATGTCAACATAGTCCACA
CATGGGTGTGTTGCTTTATTTATTAAGTAATGGTTGCAGATGTACTTACCTCTGGTGTTC
CTTCTGCAGCTCTGGAGCTTGAGATGAACTGGTCCGACTTCTAGAAGAGAAGGTAGGCAT
CTGTGTGTAGAGTCAAGGTTTTAGGTTACCTGTTCCCCTTCATATCGGGAACGGGTGAAT
TCTGAGGCATTCTCATTGTATATAGAGAGCATGAGAATTTTGTGTCTGTAGAACGAAGTT
CCATTATTTAGTTTTCTATGCGTCAGCCCTACTCTGAAACATGTCACAATGTTAACATAA
AAGATCTTTTGAAAAAATTGGCTTTATTTATAAAATTTTTACTTTTATGTTTGCTTGCAT
GTCTGTTCCATATGTGTGCAGTGCCCCTGGAGGCCAGAAGAGGGCATCAAGAAATTTTTT
TTGAAAATTTTAGTTTTATTTATAAAACTTTTTTATATGTTTTGCCTGCATGTCTGTACC
ATGTGTGTGCAGTGCCCGTGGAGGCCAGAAGAGGGCATCAAATCCCCCTGGAATTGGAGT
TACACTTGGTTGCTAGGAATTGAACCTAACTCCAAGAAGAGCAGGCAGCCAGGGCTCCTA
ATTGCTGAGCCCTAAACTTTGGCAGCTCAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved