Mus_musculus Locus Poly:16:SNORA73
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:16:SNORA73
Mus_musculus
Poly:16:SNORA73
4
SNORA73, SNORA73
1001..1205, 1454..1658
2658
AAGTTTTTAATTGTAGCATCTATGTTCTGTATCAACTGTTCCTTCCACAAACAAAGTAG
ATTCAAACTCTGGAATCTAGAAAATATTTCTCTAGGCTTTTTTTTTTTTTTTCATTTTGC
ATATACCAGTGTATCCAGGCCGAGAGGACAAACCTCACAAGCTCAACAATTTCACGCTAA
GACCGCCAACACCTTAGTAGGGTAAAAGTTCTCGATCCCATCAGCCTTAGCGCATTTCCA
ATGCTTCTAAGTGAGCGTAACCCTGCGCAGGCGCAGGCATAGTCGACCACGCCTGACTTC
CGGGCGTTACTTAAGGTATAAATATGGCTGCGTCGGCGCGGGTCTGTCTCTCTAGGCGTC
GCTCTCTTGGTGTGCTTGTTCTTGGTGAGTACAGTGCGCTGCTCTCGGCTGCTGAGGGTT
TGCCCGCGCGGTCCCGCACGGGCTCCGCAGACAGGCAGGGTCGCGGCTGGGCGGACCCGG
TGTGGGAGGCCGGGCTCACTAGCCGAGCATGGCGTGAGGTCACGCGCCTCCGAGCCCAGT
AACCGTTTTCTTTCGGGGATCCCAACGCTCGCAGGATTATTGCCTGGGAGACTGAGTTGG
TCTACGCACTTTCCTTTAATGTTCACTTTAAGAGGACAGGGTCTTTGGTTCCTGCCTTGT
GATTTGAAGTGTTAGCCGCCTTCCAGCGTTCGGTTTTAACTTAATCATTTCGCCTTGCTT
CCCAGTTATACTTTCTCTTCACCTTGTAACGGGATTTCTGCAGTTTTTTGTTCATTAATC
TCCCATTTTTCAGAGGACCCTTTTTTAGGTAGATAATTTCTGGATAGTTTGGTTCCGATG
GGGGTGTTGTGTTCTGTTTGCTTCAAGATCTGAAAAGGTGGCTGAAGTCTGTAGTCACAG
CACTCTGGAGACAGGCGTTTTTGGGGTTTTTCCTCCAGCTGGAGGTCTGGCAAAAGGACC
CTGTGGCATTTTGTCAAAAAAAAAGACATTACCATGACTATCCGACGTGGATATCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCTAGTGGCGAGCGGGAGCTTAGGGCATTGCCCGGTG
ATGTACAGTCCCTTTCCACAACGTTGGAGATAAAGCTGGGCTTTCGAGTCTGCGCCTGCA
TATTCCTACGACTTCTCAGAGTCCTGTGGACCATGACTGAGGAGACAAACCATGCAGGAA
ACAGTTTTTTAAGTCATGCAATCTGGGGGTGCGTCCGAGTACTCTAAGGGTTTAACTTAC
TGATTAAAGTCTTCTCTTGCAGACCCGGTCAATGATTTCAGGTACTTTGTTGATGGAGGT
ACGTTCACCCTGAGGCTGGCTTAGTGCTTTCTGCTCCATGTGTACGTTATTAGTGATATA
CACTGTGTGTGTGGGGGGGGGGGGTGTAGTCGCCTGTTGAAGTTGACTAAACGTTTGGGT
GCTAACCAGACATTCCAACGTGGATATCCCGGGAGGTCACTCTCCCCGGGCTCTGTCCTA
GTGGCGAACGGGAGCTTAGGGCATTGCCCGGTGATGTACAGTCCCTTTCCACAACGTTGG
AGATGAAGCTGGGCTTTCGAGTCTGCGCCTGCATATTCCTACGACTTCTCAGAGTCCCGT
GGACCATGACTGAGGAGACAAACCATGCAGGAAACAAAAATTTAAATTCCTAAGGCTTTT
GGTATGTCAACTTTAGGAACCTGATGTTTGTGTTGTTTTTTTTTTCCCCTCTTCCAGGAA
AGAAGAGAATCAGCGGGGGCACCTACTGAATAGTTATTATATACAGCGTGCTAAAATTTT
GTCTGTTACAGCCTCGGCCATTAGAAGCTGGGGCAAGCTTTTCTGCCTACTTAACTCTGG
TAAATACATTTCTTTTGATAGGTTATGTCTAGATTTGAGAACCTTCACCATGGTTCTCAT
TTTTTGAGGTCCCAACAGGTTTCCCCCAGACCATATTATATAAACCATATATGTCATTTT
TCTGTTCCCACATTCTCTGTAAGATTATTGTCATAAGTTAAAATCTGAATTAAAGCATTT
GAATGTCTTTTCCTGTGATTTAATGTGTGTGTGTGAGCAGAAGGCTGCAGGTGGGTCAGG
ATAAACCCTGAGTGAGTGCTTGGTCCCTCCAAATACTAAGATTGTTCCTTCCTCTGCTCT
GGAGTGTGAGATAGGAAACTGGTCGAATGGATGAGTTATGTGGGAAGTTAGTCCCAAGCA
GTTCAACATGGATAGGCCTAACAGGGGCCTTATGATATGAGGTAGACTGGTCCCTAGGTC
ATAATGGAAAATTGATGACTCTGCTGCCTGCCTTGATCATGGAAAAGTTAAGACCCTCAG
TGATGGGGCCACTGGGGAGATACCTTGAAGGTAGGCCTTAGAGATGCTGTGTTTCCCTGT
TCTTGAAAATGGGTGTGAGAATTGGTGGCCTCTGGGGTTGGGGAGTGTTTGCACTTAGAC
CAGAAGGGATGTGAAGCAAAATGGAGCTGCAAGACTGGCTAGTGGAGCCCCTAGGTCTAC
TTTTTTTTAAAAGAATGATTTATTATATGAAAGTACACTGTAGCTGTCTTCAGACATCCC
ATAAAAGGGCATCAGATACCATTTAGGTTGTGAGCTACTACATGGTTGCTAGGATTTGAA
CTCAGGACCTTCAGAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved