Mus_musculus Locus Mono:141:SNORD95
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:141:SNORD95
Mus_musculus
Mono:141:SNORD95
8
SNORD95
1001..1068
2068
TTAATACAAGAATAGACTATAGACTTCAGGGAGTCTGAAGAAAAGGTTAATTAAATTGT
TTGACAGATCCTCAAATATCACATTTCAAATGGCCTTTAACAAATTTTCTCATTATGTTG
TAAAATTTTATGATGTACACTATAGATTTTTTGAAAGAAGACATTTTTTTTCTCAGAAAT
GGGTCAAATGAAGATAAAAATTTGTCCTTAAAGAGATGAGAAATATGTTCCAACAGCTGA
TGCAAAGTCTGCTTGAGAATTGGAAAAGCACTTTTATCATACAATTGGCATATTTGTAAA
TATACATTAATATATTTTAAATAGTTATTTGATAGAAAATTATTTTCTCAATATATTATT
GTACCCAATATAAATTATACATAATTATTATATAGTAATGATAAATTATAATACATAATA
TATACATACTACATTACATCAGAAGGGAGTATATTTACAAAATGAAATAGATGTATTTGA
ATGCAGCTAAAATGCATTTTGACTTGACAGAGATTAGTCAAGTGTTTCAGACATTTTCTT
CATTAATCTCCCCTTTATAAACTAAACAATGTTACCAGGCTAAAAAATATTTTTTATTTT
TCAGTTTGGTATATCTGATATTCTGGTATTCCTGATACATTTATTGATCATTAACTATTC
AAACTTGTTTCAAGCATATATCTATCTCTATATCTCTATCTATATCAGAATTAGAGATAG
GAAAATGAATTAACTAAAAGTTAAGACTTGTAGTATTAGCTACACTACAACAGAAGAGAA
TATGTTTAAAAATGCAATAGATTTATTTGAATGCAGCTAAAAATACATTTTGACTTGCAT
CTGTATCTAAATATAGATACAGATACAGATGATACAGATGATACAGATGATACAGATGAT
ACAGATGATACAGATGATACAGATGATACAGATGATACAGATGATACAGATGATACAGAT
GATACAGATGATACAGATACAGATACAGATACAGATACAGATACAGATACAAGACCTCAA
CATGCCATCTAACTGTGGAGCTGAAAATCCAGAGGCTGTTTTTGTACTCCCTCCACCCCA
CTTGGGTGAACTCTGAAGGAGACTTTCTCCTCCAATCTTCTTTCTCATCCTTTCTTCTCT
CTGTTCTCTCCCTTCTGTTGTACCTCATGTCTTTCTGAAGCTCATCAGGACTTCCATTTG
CTTCAACACAATTTAAAATGGCTCATGGCTAGGATCATGTCTGGCCTCAAACTTCAAACT
CTCATAAGTGAGACATTGCTTCTTAGCACAACTTCTTTATGTCAGTCAATCCAAAATAGT
CAAAAGTACCCTCTAGTTACTCACCAACACAAGCACTGTAGTTCTAATATGGAATTCATC
TCAACCTCAGGTAGTGGTGCCCATAGTCTCTTGAAACCTAAATTAAAAGGCTCAGGTTAC
AGCTAAGACATCCCAGCCTCTTAATTCTGAATGATTTTGTCACTCAAATACTCTCATAAC
TTCGTGCTTCTTTAGTAGATACAGTAAGATTCCTATTATATCACCAATGTCCTGGAGGCC
GTGCCATAGATCAACGAGTAGACTTCTGGGATCCTCATGGGTTAAAACAAACAAAGGAAC
AAACGAACACTAGTGATATCATGTTACTCCTTAGGTGTAATGTGTCCTTGTTGTTAAATC
TATTAAAATCTAAGTCAATCAGGATCTTGCAATAATATTATAAACCAGTTATGAGGAGAA
GTATTAAAATCATAGAATTGGCACCTACCATCTACAGGCTAAATTTTTTGACCTTTAATA
GCTGAGAGTGGAAAAGAAATACTGTGAAAATTCGTGGAGTTTTATGACGGATTGGTCTTA
TGAGAGCCTTTATCTGTGAAAAATAAATCCCATTTAACTTCCCAAAGAAACTATCCCCAG
GGACCACTAAGTCCAATCACAGCGATTAAGCATACCTTTTATAACCAAGTCAAAGGTGCC
ACAACCCTCACTGTGCCATAGAAACTCACCTTAAGAGATCAGATGTCCTTGAGGAAACAA
AATCAATGTAAAAGAACCCAGACCCTAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved