Mus_musculus Locus Mono:199:SNORD38
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:199:SNORD38
Mus_musculus
Mono:199:SNORD38
X
SNORD38
1001..1065
2065
CTGTAGCAAAGGCTAGCCTAAAAATCGTTTTCATCTTCCTGCCTCTACCAAGTTCTATG
GTTAAAGGTACACACCACTGTCTGAGTCACATCTAACTTCCTAAAGGCATCAGCAATGGA
AAACCTACATAAAAATCACTTATACAGAATCCCTCTTCAACACTTGCTTGTCACTTCTTA
CCTCTTATTTGCAACATCATGCAAGCTCAGGAAGTAATGTTCCATTGTTAAAACAACTAA
CCTGTCTGTCACCCAAACTGTTATGGGATCTGCACTATGTCCTAGAAACAGAAAGGCAAG
TGGGTTGAATGAACACTTGAATGGAGCACAGTAAAGAACCTCCAAAATTATGCAAGATAT
TATCTCTAAAATTATTCGAGATAAAGGCTTACACAACATGCCTCATAGGGATGGGCCACA
AAAGCTGGGGAGATTGCTCAGTCTGAAAGTGCTTGCCACGTAAGTTCAATCGCTAGAATA
CTGTGCTGCTAATTTTAATGTCAACATGACAGAAGCTGAAGTCATTTACCAGATTGGTCT
TTAAGCAAGCCTGTGGCACGTTTTTTTTTTTTTTCACTTATGATTGATGCAAGTAGGCCC
ATCCCACAGGGGACAATGATACCCCTAGACTGGTAGTTCTTGGCATGACAAGAAAGTAGA
TTTAAAAAGCCATGGGAGGCTGGACAGTAGTGGCACATGCCTTTAATCCCAGCACTTGGA
AGACAGAGGCAGGCAGATTTCTGAGTTCAAGGCCTGCCTGGTCTATAGAGTGAGTTCTAG
AATAGGCAGGGCTACACAGAGAAACCCTGTCTTGAAACAAAACAAACAGAAAAGAAAACC
ATGGGAAACAAGCCATTAAGCAGCACCCTTCCATGGCCTCAGCTCCAGTTTCTGCCTCCA
GGTTCCTGTTCTTGCTTTGATGATAGATTGTGATGTGAAAGTGTAAGTTGGAATAAACCA
TTTTCCTTTTTATCACAATAAAAACCCTAAAAAACCCCACATTTTATGAAAAATGTGCCA
GTTCTGCTGCTGACCTCTAAGTGAGGATGAAGTGTATCTGAGGAGACAGTTAAAAAAAAA
GAAAAAGAAAAAAGAAAAATGTGGGCACTTCAGAGGAAGAGGCAAGTTGACTGCTATAAG
TTGAAAGTCACTCTGGTCTATGTATCTCAAGTGTCAGGGCTGTATAGCGAAGCTCTGACT
CAGAGGGATTGGTGGTAGACAGAGACAGACACAGAGAGACAAAGAGGAAGAGAGAGAAAG
AAGAAAAATGCTGAAAGGTGTACACTTGTAATCCCAGAGATGAGGAGGTGAGACAAGAGG
CTGGCCTGGGGTTCACTGGCCAACCAGCATAGTTAAATCAACAGTTGAATATCAAAGCCA
GATAAAACCCTGTCTCAAAAACCAAGGTGGAGGGCTAGAGGTGTGGGCTAGATTGCTCAG
TGGTTATGAACTGATTGAAAACAAAACAAAAATAAAAAAAAGCAACAGTGCTCTTCCAGA
GGACCTGGATTCAATTCTCAGAACCCACATGGAAATTGACAACCATCTGAAATTCCTGTC
CCAGGGGATTCAACACCCACTTCTGGCCTCCACAGACACTGTATACATGCGGTACACAGA
TAGACATATAGGCAAAGCACTCACACAAATAAATTTTGAAACAAACAAACAAACAAAAAA
CCAAGGTGGAAGGCCAGGCACATAATCCCAGTAATGGGGGATGGAAGCAAAAGCATCAAG
AGTTTAAGGTTATCTTCAGTGATATAGAGTCCAGCTTGAGGTTTATGGGATGGGGGGGAG
AAGGGAGGAAGGAGGTGGAGGAGAGCCAGAACCACCCCCCCCCTCCCAAGATGAAGGAAA
GCAGAAAGCTAGGGAGATGGTTCTGAGCTCAAATGACCAGTACCCATGTAAAAGCTGGCA
GTGATAGCATGTGCCTGTAGTCCCAGAACTGGGGAAATGAGGGAGGTAGATACTAGAAGC
TCATTAGCTGGTTCACTGAGAGTTGAAGAATGATAGAAGAATTATATATGGTGTCCTTCT
CTGGCCTCCACATGCAATGCAAACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved