Mus_musculus Locus Mono:243:SNORA73
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:243:SNORA73
Mus_musculus
Mono:243:SNORA73
15
SNORA73
1001..1198
2198
AAATCACTACTCAAATCCAATAAGCGAATGGGTGGTTATTGTTCCGAGGTTCATGTGAC
TATGGATCAAATGCGCATATTTTGCCAGGTCAGTTAATACTGACACTCACAGGAGGCACA
GCTGTTGGTTGGTCTTCTAATACCCTAGTCTGCATGGCATGACTCTCACCGTGAAAGCTA
ACCAGTAGGGAATGAAGTTTCAGAGTCAGTACCCACTTTATATCTCCATACTCTCTGCCT
CGAGAATCTTGTATCTTCAGCAATAGGCTTTTGCCTTCCATTTCTGTAAACCTGTGTGTG
ATATTAAACATGAGAATAGTAGTAAACAGTCATCTAGGCTTTGAAACATCAGAGGCATAG
ATCTTGCTCCAAGAAATAAATTGGGGTGGGGTGGGGGGGCTGGCCAGATGGCTCAGCGAG
TAAGAGCACTGACTGCTCTTAATGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC
CACCTGTAATGAGATCGGACACCCTCTTCTGGTGCATCTGAAGTCAGCTACAGTGTACTT
ATGTATAATAACAAATACATCAAAAAAGAAAGAAAGAAAATGGACAAATTGCCTTACTTC
AGGTTATTATTGCTAATATGAAACACCATGGTCAACAAGGAGTTGGGGAAGAAAGGGTTA
ATTTGGCTAAATGCTTGTTACCACATCCATCTTCCATCACTAAAGGAATTCAGGATACAA
TTCAAACAGAGTAAGAATCTGGAGAGAGGAGCTGATGCCAAAGTGCTTACTGGCTTGCTT
ACCGTGGCTTGCCCAGCTTGCTTTCTTAAAGAGTTCAGGACTACCAGCTCACAGATGCCC
CACCCATAATAGGCTGGGTACTACCCCATCAATCAGTAATTAAGAAAATGCCTTACAGCT
GGATCTCATGGAGGCATTTTCTTATTTGAGGTGTCTTCCTTTCAGATGACTCTAGCTTGT
GGCAAGTTGACCAAAAAATTAGTTCACCAGTTGTGGGTAACTGAGTATGTTAAATTGAGT
GTCAATAAGAATTCCCCAAGAGTGGCTTATGGGAACATAGGGTTCAGCCCAGTGGTGTAC
AGTCCCTTTCCACAATGTTGGAGATGAAGCTGGGCTTCGAGTCTGTGCCTGCATGTTCCT
CCGACTTCTCAGAGTCCTGTGGAGGATGACTGAGGAGACAAATCATGAAGGAAACAGTCT
TAAAAAAAAAAAAAAAAAAGAAATCCCGAACAGCTTACAACTCCATCTGACACTGGTCAT
GACAAAGCAGCATATAGAATGGAAAAAAAATCTTTGCCAGCTATATATCTTACAAACAAT
TAGTGACTAGACCATAGAAAGAACTTAAGAAAAATGACCAAGAAACTTAATAATCCAAAT
AAAAAAATGGACCATAGAAAAGAATATGATGTTGGGAGGTTAGGGAGGTACCATGAAGTG
GGGGTGGGGGATGTGATCAAAATACATCATGAAATTTTTTTTTAACTAAAAATAGGTGGT
GGAACATAAGAGTAAGTACTGAAAAGAAGAAATGTAAATGTCTAAGAAATACTTTTTAAA
TATTTAAATTACTTGCATATTTAAAATGTTCAACTTAGCCATTAATGAAAAAAACACTCT
GAATATTTTAAATTTAATTAAAAATATTTAGATAGATGTAAAAGAATTACATCACTTTCA
TCCCTCCTTCTCCTTTCACTGGCCCGTTCCAGGTATCATGTCCCTCCAGCCCTTTCCATG
TCTTCATGCACACTCTCAAGTTGGTAGCTTCTTTTCCTTTGATTATTATTAAGATATAGA
TATATGTGTATGTATCTGCTTACACAAATATATAAATACTGAGTCTGCTGTTGTCGTTTT
TATGTGTGTGGTTTTGGGGCTGACCACTATACATTGGACAACCAGTAAGGGCGTCTCATC
CTCAAGAGAGGACAGTTCTCCTTCTAGCTGTCATTAGTTACCTGTCATGAAAACTCTCCT
CTTCTGCATACATATGTCCATTGGTCTACTGTATGTGTATGTGTAGGAGAGATTGTTTCA
CGGCAGATTTCTTAGTTTCTGACTCTTACACTCTTTCAGCTCTCTCTTCAGTGTTATTCC
CTGAGCCATAGATTCATGAGCGGTATTTCAGGATATATCTGCAGTCCCATTGATCAGTTG
TGGTTTAATATAATTTCTCTATTTGCTGTAGAGATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved