Mus_musculus Locus Mono:454:SNORA17
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:454:SNORA17
Mus_musculus
Mono:454:SNORA17
4
SNORA17
1001..1132
2132
AATGGAATACTACTCAGCTATTAAAAAAATGAATTTATGAAATTCCTAGGCAAATGGAT
GGACCTGGAGGGTATCATCCTGAGTGAAGTAACCCAATCACAAAGGAACTCGCACAATAT
GTACTCACTGATAAGTGGATATTAGCCCAGAAACTTAGGATACCCAAGATATAAGATACA
ACTTGCCAAACGCATGAAATTCAAGAAGAACGAAGACCAAAGTATGGACACTTTACCCTT
TCTTAGAAATGGGAACAAAACACCCATAGAAGGAGTTACAGAGACAAAATTTGGAGCTGT
GACGAAAGGATGGACCATCTAGTGATTGCCATATGCAGGGATCCATCCCATAATCAGCTT
CCAAATGCTGACACCATTGCCTACACTAGCAAGATTTTGCTGAAAGGACCCAGATATAGC
TCTCTCTTGTGAGACTATGCCAGGGCCTAGCAAACACAAAAGTGGATGATCACAGTCAGC
TATTGGATGGGTCACACGGCCCCCAATGGAGGAGCTAGAGAAATTACCCAAGGAGCTAAA
GGGATCTGCAACCCTATAGGTGGAACAACAATATGAACTAACCAGTACCCAGGAGCTCTT
GTCTTTAGCTGCATATGTATCAAAAGATGGCCTAGTCGGCCATCACTGCAAAGAGAGGCC
CATTGGACTTGCAAACTTTATATGCCCCAGTACAGGGGAACGCCAGGGCCAAAAAGGGGG
AGTGGGTGGGTAGGGGATTGGGGGGGTGGGTATGGGGGACCTTTGGGATAGCATTGAAAA
TGTAAACGAGGAAAATACCTAATTAAAAAAAATTAAATTAAATTTAAAAAAACGAAAAAA
AAAAGAAAATGATATGCTTAATTGAGCTTAGCTCTAAGTAAATCTTCACTCTTACACATT
AGACTTATCATTAAAAATTCTACATCTACTGGTTGATATTATTGATACTCTCTGCCACTT
CCTAGCATGTGAAACGCTAAGTCTTAAAAAGTTTAGAGCTCCCTGCCCATAGAGATATTG
CAGGTTTGGCTGCTGTGTCACATGTGCGTCAGTAGGTGGCAGAGGGGAGAGAGGCTATGT
CTATGCTCAGTGTTCAGATCTAGGAACTTCTGAATGTTTCTTAGCCTAACACTTCCAGAA
AAAAAGGTAGCCTGAAACAATCACCAGTCCAGGTTCTGCCATGCCCTAACTGACTCCCAG
GGCGGAGAGTGAGCCACAAGCTAAAAACAAAACAAAACAAAAACAAAAACAAAAACAAAA
ACAAAAAACAATACCCACCTGTCACCAAGGGCCCCAGGCAGTAGTGAGCCTAAGATGAGT
CTCAGCCCACTGCCAGTCCAGCTTGATGGGGCCTGGACAGGGAGGAAACTTGAAAGTACC
ACTAGTTGGGTGCCACACAGGTCTGGAGGGACAGACCATGCCCTCCCCAGTGCCATTAAG
AGCTCCCCTAAAAAGTAAAAAACCATAAGAATAAAGAAGTTTCCGTTTCCCAGGAAGTCA
GATTGGGCTTCACACAGACGTTGACAGTGGCCTGTTGATCACTGATGATTCTGTAAGCTT
GGAGTTGAGTCAGTTCCTAAAATTTCTCCAAGGCCTCACCAAATTATAGTAAAACTAACA
TAGCAGCCAATCAGAAACCAACCCATGTAACTTCCCTGGCACCCACCCATGAAGTTTCAG
GCTACCTAACCCTAGCTAAAATTCCCCTAGTTTCCTATCAAAGGTTTACATGCCTTTGAC
TGGGATCACCATTGGGTCTTCCTTCAATGACTTTTGGACCCTAACACCATAATGTACAGG
TAGAGCATAGAACCGAGACAATCCCAGACACTCAGAGACACCAGGCTCCACTAAGAAAAG
AAAGTCAATTGTAGAGAAATAGAAGAGAAAGAGAAAAGGAATGATATGGACACAAGGAAG
AGAGGCAGAAATGAAGAATTAAGGATAGAGGGGAACAGCCTGATATGAGTATCCGATGAT
GCCACTTGGGTCCATGGTGGAGTTCTGGCCTGTGCTGCTACCAGGAGCCATGTCTGAGTT
CATAGCGCTGCAGCAACAGGGGTCTATCATCACCAAAGACCAGGTAAAAAAAAAGAGGAA
AAGACCACCAAAGACCCTAATCTACTACCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved