Mus_musculus Locus Poly:9:SNORA40
snOPY snoRNA Orthological Gene Database
Mus_musculus Poly:9:SNORA40
Mus_musculus
Poly:9:SNORA40
9
SNORA40, SNORA18, SNORA8, SNORA1, snoZ40, SNORA32, SNORA25
1001..1123, 2251..2381, 3294..3430, 3638..3770, 3971..4044, 4938..5037, 5125..5257
6257
CAGAATTCTCAAGGAAGAGAAACTTGGAACAAGAGAAGATTAAGAAAGAATCTACATTT
TCTAAAAAAGCCAAAGATGCCACACACAGAGAGAAAGGGCACAGAAGAACCTTGAAAGGA
AATGAACATGTGACTATTGAAGAAGGTAAAGAACATAGATAACAGTGTATGCCAAGTAGA
TCAAGAACTAATCTGGGGAAGAAGATAAACTTGCTGGTGGAACGCTAATAAATACTTAGT
AAAGCTTTTTTCGTTGCTTGATTTCAGAGTAAGAAATACTATAAGGATTATTTTACTACT
ATAGTAAACATGATTGTGATTCTGGAAGGAAAATGCTAACAATCCTATACATGTCTAGAT
TCAAGACCCCAGCCTCGCCCTTTTGCTCATCTGCAGAGCAAGGTCATGAAGAAAGGAGAG
TTAGAGTATCTGGAGGTTCACCACCTCTGTGGTCTGTCGCAGCCACTATGACTATGAGGA
GGAAGAGATGATTTGAAAATTGGATTAAACTCCTGGACTCTTATACTAGAAAAAATAAAC
TAATGATAAAACCCAGCCTCTTAAGTGCTTAGCCCAAATTATTTCATATTTGTGTGTTTT
GCCTACATGCATATGTGTGCAGTACCCAAGATCAGAAGGTATCTGTGCCTGGAGATCTAA
AGTTACAAGATGGTAATTAGCCAGCCATTGTTGGTTATGAATATGATTTCCTTTCCTATT
CATAGATGGGCAGTGGTGGCGCATGCCTTTGATCCCAGCACTTGGGTGTCAGAGGCAGGT
GGATTTCTGAGTTCAAGGACAGCCAGAACTATTCAGAGAAATAAAAAAAAAGTTATTATC
TGAGCTTTCTCTTCGAACCCACACCCAGGTTCTGTCTGCAAGTCTTAAGTCAAACAAGTG
CTTATCTTCCCCAAGGGGGGTTTGAATATTACCACTGTTCCTACTGTCCTATTGTGGTCA
CAATTGTAAAACTGGCTGTGTCAGATATGGACAGCTTTGATAGCACTTGTGTTTTTGTCA
GCTGTTGGACAATGGCCAGTTGAACAGGTGCAAAAATATAAATCCTCTTGCAACCCAGAA
CTCATTGCTCAGTATGAGTTTTGATATATACAAGAAGGAATATAAGCACAAAGGTGTTAT
TGATGAACTTGGTTCTAGCAATATCATATATAGTTTACCTTATAAAGGTAATGGAGTAGA
TGGATATTCCTTTTTTTTTAAAGGCTTGTCTTGATTATGAAGTCAGAATTGGAAGATACC
CATGAATGGATGTTTGTTTCAGTGTTGTAAGTAGCATGTAAATTTACATCTTCGGAGTTA
TGTTAACTTTCAGTGATGCTAATTCTATGAAAGTTTTAGAGTGCTCCAACCCCTCAGTAA
ATCCTAGAACATTAGAATCAATAATTTGAACTGAAATAGGTATGTTTAGCAGAAGAACAC
AAAAATAAGGCTTTAAGGTCTTATACTCAATTTACAATATTATAAACTTCTCAAGCATGG
TACATCACAAATACAGTGTTTGAAAAGTGAGTTAACTAAGAATCAGACTGCCACTTTATT
TAGTTTTATCTATCTGCCTGATGTAATTGTCTCTGAGCCTTACTGCCCATCTGCTAAAGA
AGGCCTATCCTTGGAAGCTTACAATCTGATGTAGGTTTAGAATGTTTTCAGCCTTGGAGA
CTTTGCTGAAAAAGCTCACCCTTGATATTGTCTGGTTTACCTCAGGTGTTCTGGCTCATT
CCTTCAAGCTGACTGATTCATTCTGACTTCTGCCTCAAACTACCTTGCAATCTGTTCTGA
TCTGGGCTCTTCACTCTTGGCTCATTCTGTATTCACCTGTGTCTAGCTTGATCTCTCTTA
ACCTGTCTTTGTAAAGTTCTCCTAGTAAAAATTGCCTCTTGCCCTCTTACGTTGCTTCTC
TTCTGACATTTGGGCATATCTTATTCTGTTAAATCTTTTTCACTTTGTCTGCTACTCAAT
TAGACATCACTTTCATGGGTGCTTTATCTTTCTTCATTGTTTAGGATTAAAGGTATGTGC
GTGTCTAATTCCAGCCAGCACAACCATGTTGCTGGGTTAAAAAAAATCACTACAGTAAAA
GCAGTAAAAGTGAGCTTGAGAGTTCAGCACTGTAAGAATGCAACCTTGAGTTTAAGCTAG
GCAAAATTCTGAGATTACAATGTGATTTCCTATTCATAGATGTCCATATAAAAGATGGCT
GGAGAGCTTCACAGTTGTTGAAATGATTGCTTTTGAGGTCTATCCCGACGGGGCTTCCCT
AGTAGCCAGACGTCGTTGGAAACGCCTCATACAGTAACTTGTGGTTTTACTTGACTCACA
GGACTGACTGTTAGGTCTGTGGGAAGGAACTACAAGACAGCTAACAAAGTATAAAACTGA
TGTGTTAATTTTGTTTTGTTTGTTTGTTTTTAACTTTAGGCACTGGCACTTCCTTCATAA
AGATTAGAGTTGTGAGTGTGAGGTAAGTTTTAGTGACACTAATTTTGGGAAAAGATAGTT
CCAGTTCAGATGATGAATTCAACTGTTCAACTGCTGAATGAGCCAAACATGAACTAACAT
TAACTCTGACAGAACTGGCTGCAGCTGGTAATCATAGTAACCTTGGCAGTTTTTATAACT
GAAATGACAGCCTTTTTAAAAGTCATGTGTTGTTCTCTAGGAATGGATATGAGAAGACCC
TAAAGAGATGTTTGGTAAGTAACTAGTTTTGTTTTTTGTATAAAGAATTGTAGATCTCCA
GGTCGCATGTAAGTTCTCAGAAAAACATTTGCTATGTGTACAACCTAGAAAGTCGTCCTC
ACTTTGCTAGGCTAGTACAAGTACATCACTCAAATGCCAAATCAGAATAACTAGAAATGT
TCATTCAGTAGGGATAAAAAGATACACCATGTACTAGTCCCACACCTAAAATTCTATGAG
TTGAGAGTCTGAGGTGAGAAGTTTCAAGTACAATCTGAGAAATGGAAACTTTGTCTCAAG
ATCAAATTCTTGGCTGGGTAGCTGGCACAGTAAATATAAGTTCAAAACCCTAGCAGCCAG
GCACGTATGATGGCTAAATCTGGAAGCTCTGATTTTAGTGAGAAGCCTTCAGTGAATAGT
ATTTGGAGTGCTCAGGGAAGGTAATCTATTATCAGTGTGTGTGTATGTACATGTACCCAA
AAGAACATTAATCCTTTTTGAGCAATTTTCCCATTGGGGGAATTTTAGCTGAGATGGAAC
TCTCATGCATAAACTCAATAGCTGAAAGTCTACCCAGTAAAGGGCTTAGGATTTTGCACT
GCATGGTATCTGCACTCAGCAGTTCTTTCCTGTTGGGTGTTCAAAAGACAGTGCTATAGA
AACTCACTATCTGGCATCGTTGGTTTCTTGGCTTTGTGCATGTTAAACCTGGTATTTCTA
ATGATACAGTTTTTCATATGTACATAAATTTTTGTATGTAGGTGTGTCGGGGAGGGCAGA
ACAACTTGCAAGTTTGATCTCAATGTGGGGGTCTTAAACTACCTGGTCTTAAAGCTTTCT
CTTCTTCCTAGGGTGACACGAGTGAACCCTACCCTAAAATGGTAAGGCATTATTTTTCTT
TTTCTTGCTGTCTTTACTTACTAGATGCATCATATATGAGCCTCATTGTACATAAGAATG
GGCATTGTTGGTCATTGTCCAGAACTGGTCGATGTGGCTAAATTGAGATACAGGTCATGC
TTCCATCACAGCAGATACATTACAGTGGTGACAATGAGACCTGTAACATTTGTCTGTTAC
ACTCAAGTATGTTAATTCATTTTATAATAATTTCTTATGATCAATTTTGTAGGTTTAAAG
ATAACATGAAGGGTCCTTAAAATAAATTGAAGAAATCCTCAAATCTTCTGGTAAGATGTT
AACTCTGAAACCACATGTGAGATGAGGTAATTCTGAAATTCACTGCCAGGTTTGAAAAAC
ACTACCATAAATGATGTTGTGATGATGGGCAAAAATGTTCAACTGCTCTGAATGGGCTGA
ATGAAAGTAGCCTTTCTGAACATCTATATTGGATAGGTCCACGTATGCAGACTTGGTGAC
TCATAGGTGAGCAAGATAGTCTAGCTTCACATAGCCCATCTGGGTATGAAGTTACAGTAC
TGTAGTTATTAGGGTATCATGTGCGACATTCATTTCCCCCTAGTTTTATTTAGCACTCAA
AATCAACCTCTATAATTCTTTGAAACAAATTTCCTCCCTTGTTAATAACTTAGAAGTAGC
CAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCA
GGACAGCCAGAACTATACAGAGAAACGCTGTCTCATTAAACAAACACAAAAACCCTTATA
AGTTGCCGGGCAGTGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGC
GGGTTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGACTA
CACAGAGAAACGCTGTCTCATTAAACAAACACAAAACCCTTATAAGTTGCCGGGCAGTGG
TGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGCGGGTTTCTGAGTTCGA
GGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGACTACACAGAGAAACGCTGT
CTCATTAAACAAACACAAAAACCCTTATAAGTTGCCGGGCAGTGGTGGCGCACGCCTTTA
ATCCCAGCACTCAGGAGGCAGAGGCAGGCGGGTTTCTGAGTTCGAGGCCAGCCTGGTCTA
CAGAGTGAGTTCCAGGACAGCCAGGACTACACAGAGAAACCCTGTCTCAAAATTAAAAAC
AAAACAAAAACCACACACACAAACCCTTAGAAGCTGTCAAAGACAGATAAGAAAGGCAAG
TAAGGGTCATTTTTATAATGGTCATTACCAAGGCTTCTAGAATGCAGTTTCTCATTTGCT
GTGGACATGACCATAGACAAATTCCCATGAGGTTCTTCATATGCTGTTGGGAACATGGTG
ATGGCTGGATGGGGTGGATGGCTGGCTGACTGGGACATTTGAGGAAGGTATGTATATGGA
AGGGGCTCCCATATACATACAATGAAGGTCATTTCAAAGAGGGCTTTTTGGGCTATAAAA
CCCACAGCTCTTAACGCTGTGACCAAAGATTGATGTTCTTCACAGAGAAAATCCTGCACT
GTTTTGATAGTGCTGTGTTTTTCTGAGAAGATAACATACCCTGAATCACTTAACATACAC
TTAACACACCCTGAATCACTTAACTCATTAACACATCTCTCATTGTCTTCTCTTTCAGGT
GACCTGGATGGACAGCAAAGGAATCAAATCCCTCAAATAATTTATTTGACTTAAATTAAA
AATAAATAAATATATACAGTAAAAAGAACCTTTTATAGTTTGTATGTATTTTGGGTCTGG
AGTTTCTAGTGTTTTATTTCAATTTGTACTTTGAATGAAAGGTCATCCTTTTTCTTGCTT
TCATTCTCTTTGCTGTTTCACCCCAGCTAACTGCCTGTGCAACCTGTAAGAGAAATTTGT
GGAATTAGGCTGGTAATATTAGCAAAATAATTAGTGCCCTGAAGACAGCTTTTTTTCTCT
TTAGGAAGAGTCACTTTATTCACACCCTGCAGGAAGCTCAAGGATGAGTCTTAAAGTCTT
TGTAATCTCTACTGTGCCAAACAATACAAATGCAGATGAAGTAGGCTTCATCCCTGGATG
GTTCAATATACAGAAATCCATAGAAGTAGATATCTCATTAGATGCTGACAGCATTTTCAG
TGAAGTAGTTTAAGTGGCCCTTCTCACAAAGAGGGAAACACCACCCTTTAGTCATAAAAA
CCAAATAGAGAAAAAATGCCCTACATACCTGTAGGTAGCTTCTCTTTGGATACTTTGGTT
TGAGGGAGTCGAGTTTTATTCCAGATCTCTCTCTGCCTCTGGTAAGATCGTTCTGTAAGT
GTCTGTCTTGTCATAAATGCTTCTTGTAAACTACCTGATGTAGCTATAATATTTGAGAAA
AATTATGCGTGGCTTTCATCCCAACATGAGTTGATAATGTTCTCAAGCTGATAAGGGGTT
TACCTGAAGGTGCCACTGTGGGTTGGTCCACATAAGGCTCTGATACAGCTCCACAAACAG
AGGTTTCCATTGAAGATGTAGGCAGAACGACACCTGCCTAGTTCCAAGAAAGTCATTTTG
AGTTTGCTAGCATCTTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved