Mus_musculus Locus Mono:343:SNORA43
snOPY snoRNA Orthological Gene Database
Mus_musculus Mono:343:SNORA43
Mus_musculus
Mono:343:SNORA43
9
SNORA43
1001..1138
2138
TATTTTTTTTAAAGATTTATTTATTTATTATATGTAAGTACACTGTAGCTGTCTTCAGG
GAGTCAGATCTCATTATGGGTGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTTC
GGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCTGGAG
TACTGTTTTTGCTTAGCTTTGTTAACTAAATTTCTGCTTAAGCTGTGACTCAACTCTTTT
GGTTATTGTGGCGGGGTCTCTTCACTTAGTCTTAGAGCTCATGAGTCCATGAACTCACAG
AGTTCCACCTGCCTCTGCCACCTGAGGGCTGGAACCAGAGGTATGTGTCACCATGCCTGG
CAAGGTTTTCTCATCCTTGATTCTCTGTAGCTTCGTCACACTGAGCCCAGGTGTGTATTC
ATTTTCACGTGTCCTGCACATCATTTACTGTGCAGGTCTGCTCTGAGGACTTGTGCTTTT
GTTTTGAACATGCGCAAACACCAAGTTAAACCCACTATTGCGTCTCTACCTGCAAGGCCT
ATTTTTTTTTTTTAAACATAGTGTCTTATGATGTTGCCCAGTTACGCATCCAGAAATAAG
CAGAGTCAATTTGGCCTTCACAACCATAAAATAACATGTCTGAAGGAGTGGGAGAACTGT
CCTCATGAAGTATAGGTAACAGGGGGTGAGAAACACATGTTTCTCTACAAGTAAAAATGG
CGACAAAACAAAAACCTCAATGTCTGGGCTTTGAACCTGTCATGCATTTAAAGCATGAGG
GCCAGAGAAATGGCTCACTGGGTAGGTACTTCTCACACAAACCTTATGACTCGAGCTCAT
CACTGGAGCCCACCTAAAGGTAGAAGGAAAGAACAAGCCCTGCAACTTCTTTGAGCTCCA
CAGTATGCTGTGGCACGTGCATATATCCCCTGCACCTCCCAAATATCATATACGTATACC
ATAACAGTTTTTGAAAATACAAAAACAGCAGCCTTCCAGATGCTGTGCTGGATCTGTCAG
GACTGCAGGAACAGCTGCTGGGCTCTGTCTGTGACAATGGGGCAAAGAGCAAGTGGCTAT
TTCTCTACTCAGTTTTCAGAAGCCAGTGAGCACTAAGAATGGAATATAGCTTGACACTTC
ATGGGGGTGAGGGGTGAAGGGAACAGGCAGGTGTCGCACGTCTTTTAATTCCAGCACCAG
GGAGGCAGAAGGTAGGCGTACCACATCCCACTCAGCCTGGGGCCTGGAACCCTGACTGGA
AGCAGGGTGAGAATGAAAATAGGCATACATACTTAGGTACAGGAAAGCTGAAATGAGGTA
GGGTTCTGGAACCTCAGCATGTTTATTAGGTACAGCACGGGGGAGGGGGAGAAGGGTTGG
CTAGTCTTGGCAGGAGACCTCTGAGGCTATAAACATCTAGGGGAAGCTGCAGTTGCTAGT
CTTTGCACACACTGGACATTGTTCATGTACACTCATACTTGGTCCCTTGAGGAAAGCTCT
GGCATTTCTTTCGAGCCTTCACCCAGGTTAAGGCTCTGCCACTTCCATGGAGCTGAGTCC
TTGTCCTTGCCTGTGTCAATAGTACACACTTACTCAGGACTTCTTCCATTCCCTACACTG
GAAGTTCTCTAAGTTCAAGGTCAGCCTGGTCTACCATACAGTGATACCCTGTCTCAGAAT
CAAAAGGGCTGGGAAATGTGGCTTGGTGATTAAGGCACATAAGTAGCTTGACTGAGATTC
TGGGGTAATCTCTAGTCTGAAAAGAAGGGAGGGTGGTGGAGGAAAGAGGCAGCTGAGAGG
ATGCCAATACAGCTCTATCGCCCAACCAATCTAAAGGGTGAGACTGGAGCTAACCAGCCT
ACATTTAAGAGTCTGCTAGGCGGACGGTGGTGGTGCACGCCTTTAATCCCAGCACTCGGG
AGGCAGAGGCAGGAGGATTTCTGAGTTTGAGGCCAGCCTGGACTACACCGTGAGTTCCAG
GACAGCCAGGGCTATACAGAGAAACCCTGTCTTGAAAAGCAAAACAAAACAAAACAACAA
CAAAAAAGAGAGTCTGCTAGTGTAGTTCAGTAATAAAGTGTATGCTGAAGACTACCACAA
AGAAATAAAACCCAGACTGAGCTCTTTTTTTTTTTAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved