Mus_musculus Locus AV478545
snOPY snoRNA Orthological Gene Database
Mus_musculus AV478545
Mus_musculus
AV478545
11
SNORD49, SNORD49, SNORD65
1001..1072, 1372..1443, 2437..2508
3508
GGAAACACTGCATCCCCAACCCTTGAGAAAATCAAACATACTCATATACTGAAGGCATA
GCATTAGCAGTTTTCTATTACCTATGCCCGATGCAAGTCTCTCCAGTCAGAAGTGGAAAG
AGCAGGGGGCAATGGAAATGGATCAAGAGCTCTTCTTGATTCTACAGTTCTCTAAGGAAT
GTGATGAGGGCCGTCTGCATAGGGCCTTGAGAGACTCCGTGGATATGTTGTAAAAATAAT
GGGGTGCAGAACGGCCCCAATCATTACACTTTTGTAACAGCGTTTGTCTTTGAACGCGGT
TTCGTGTGTGTTAGCGTAGATGAGCCAGGCTCTCCACCACCCAGTTAGATTATATAGGCC
CGCTTTTTTTTTTTTTTTTTTAAATTTAAAATAGAGACAGGGGCTCATTAAATTGCCCAG
GCTGGACTCGAATTCTTGCGTCGGGTTCCTAATCGATTACGATTACAGGCCTGCACTGTC
AGGTCTGACTACACATTTCACACACTACACACGTTCACAAAGGACTAATAAGTCAGGGAA
GACAACGAGGACGGAAAACCGCGGAAAGGATGTCGAGTCCGCGCTTAACCCAACACGCAG
GCGCGCTGGAGCTCGCGCGCTCTTCGCTACCCAGAATCCCCCGGGGCGGGGGAGACCACT
CGCTCAACAGAACGGGGGAGGCCTGGGTCGCGAGGCGGGCCGCTGGAAGTTCCCGTGAGC
CTTTGCCGCCCTCACCTCCCTGGGGTGAGGAGTGGTCTATTCCTAGCCCTTAAGAGGAGG
GCGCTCACGCGCCGTCTTTCTCTGCGGCCATCATGGGATCGTGCTCTTCTCGCTCGTTGA
GCTGGTCCCTTCGCCGTGGCCTGCTGGTGACGGTCTGGAGCGATGCTGAGCCCGGGCCCA
GCCTCTCAGCTCCGCCTTGTGCGCTGCACAGATCTAGGGGAGCCTGGTAAGTCGAGGTCT
GCATCGCGGGGCGCCGCGCGTGGGCGGGGTGTCGGCTGCAATGATGATGAAACTAGAAAA
AAAAGGAAGTGCCGTCCGATGCGACAACTGACGACATCCCTAGTTAGCTGACTGCAGTCG
TTTAAGCCTCGGCGACCCAGTGCTGAACACAAGTGTTCTAATTGCCCCTCATGACTCTTA
CTCTTCTAACCTTTCAGACGGGACGTTGACAACGTGGAATAGGAGCAGTATCATCCCACC
ATGAGGTAAGGGTTTCTGGAGTATCAGGTGGGGTTCATAGACAAGAGGCTGTGTAGCTTT
CGCTCCAGGGACTCCCAACATACCCTGGCCCATGTGGGCACATACATAAATTTAAGACGT
GTCTCCATTTAGTGGCTGGAACTACTAGTTGGAGGACAGCAGAAAGCTTGACTGCTGTGA
TGAGATGACTAAGTAGGAAGTGCCGTCAGAGTCGATAACTGACGATAACTGCTCCTGGCT
GACTGCAGTCAAGCCCACACCGGTGGCTGGGGTTTAGGTTTAACTTGGGCTGGACTTTTA
ACAACTGCTGTACTTCTAGGTTGGGGATTTAAGAGTGGAAGATTGCCAACAGCTGTGGCC
TCCCATGAGGTAAGCTTTCAGCTTGGGATTTTAGACCGTTTTGATTTGAGCTAGAGTGTT
CATGTATGAGCATCAGTTTTGCCTGTACTCAATACTGGTTGTAGCTGATGGGGGTGGTTA
AGTAAGGCAACAGTGCACAGCTCTTACTGTAGAGCCATTTTTTTTTTAAGATTTATCATA
TCTAAGTACGCTGTAGCTGTTTTCAGATGCACCAGAAGAGGGCATCAGATCTCATTACGG
ATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCGGACCTTCCGAAGAGCAGT
CGGTGCTCTTAACCACAGAGCCATCTCCAGCCCCCTATAGAGCCATTTTTGTGTGTGTTT
GCTGTCTTGATGCTAGAAAAAAATGGCACCGGACTTAGGTGGTTGTGAGCCACAATTAGT
GCTGGCAGTCAAACCTGGTCTTCTAAGAACTTAGACCTTCTAGTCCATTAACTTGGGTCT
TAAAATTTTCAGTTAATGTGGTCTTACAATTGAACCCAGTTGGGCTGGTTTGGCTAGTTG
TAAATGTATTTTAGTAATTTGAAAAATACTTCCCTTTTAGGTCTAGGATGTGTTAAGAAC
TGTAGCTTTCTTGAGAAGAGGCAGGCAGAGTTCAGGCCAGCCTCGTCTACAGTAGTGAGC
CAGGGCTACAAAGAAATCCAAAAGAGAAAAGCCAGGGTGGGAGGGCAGCCATTGATTTTG
CAAGGCTGTTATATATAATGTCCTGTTTTCTGCAATCCATTTTAGGGTGTCCCCTTTCAA
GTTCTCAGAACGGACGCAGGACTGCAGATCTGTGCTGGCAGCAGCAGAGGTGAGTTGGTC
TGTACAGTGACTATCTGTTATTACTCTGAGAGATATCAAATGATGATATCACCTAAAATA
GCTGGAATTACCGGCAGATTGGTAGTGGTGAGCCTATGGTTTTCTGAAGATATCATTAAA
TGTTCTAAATGCCATTGATCCAGGCAGGAGTGATTCTGAAATTCAGCTCTTTTGCAGGCT
ATATTCCCAGAGGAGTCTCCAGCCGGCCTGAAAGCAAATATCCTAAGTGACATGTCTGCC
AATTTTGTTCTGGGTGGGCACATTTGGTAATCCTGTCTGTACCACAGGATCTTCTATGCC
TTTTAAAAATAAACATTTGTTTATAAACCAGATTGCCAGTGTTTTGGATGAATTAAGTTG
TGTGTACAGCTAACCATCAAAGCACTCTAATAAAGCACAGTCCGTATTGGTCCTTGAAAA
CATGTATTAGAGTAGAGTGTCAGGTGTTAGGCAGTCCAGCTTCAGCACTGTAAACTTCTG
GGCAGTCTCAGCTGTTTGCACAGCTGGACTTGGGCAAAGATTCCAAAGCATTTAAGGCAC
CCACACTCAATCCCTGTTCTTGGCTGCAGTGCCATGCAAAGACGCCATCTTGTTTGCTTA
CCTGGCCTGTAAGGCTGTTCTTCCCCATAACCCCATGAGTTCAGACTTTGACCACTTAAT
TCAGAACAGTTCTCTTGGGCTTGAGTTGGGGACTAGGAGTGTTTAAGGGTGTTAGGAACA
CCCAGTTTTCCCTCTTTGCTAAGTAGGACTGGTTCTAGAGGTGAGTTTTTGAAAAGCCAA
TACAGGGACTAGATTATGGGAGGACCTGGTAGAAAAAGTTGTGCTGGTTGGTGGATAAGG
GAGCTAGGCCCTATATAGATAAGATTGCCTAAAAGGTCTGCAGCTTAAACTGGATTTTCC
ACACTTGGTATTCTGAAACTTACTGCCTTTAAGAAGGCCTTGGGAAGTAGGCAGATGCTC
CTAGAGTCTTAGAGTAGGTGCCTGTGCCTAAATTGTAAGTGGGCCCAATAAAGAACTTCT
GGTCCAGATGCACTGGTCTAGGAGGACAGCTGAATGGAAACATCCGAGCCCCTTGAGCAA
GTACTGGGAGTCGGGTTTGAGGACAAACT
  Untranslated Region
  Coding Sequence
  snoRNA
823..945, 1157..1204, 1519..1568, 2325..2388, 2577..2726
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved